Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8945

Zcchc3 zinc finger, CCHC domain containing 3 ( MGI:1915167)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945
"Pseudo-wholemount" of euxassay_012888. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012888_01 euxassay_012888_02 euxassay_012888_03 euxassay_012888_04
EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945
euxassay_012888_05 euxassay_012888_06 euxassay_012888_07 euxassay_012888_08 euxassay_012888_09
EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945
euxassay_012888_10 euxassay_012888_11 euxassay_012888_12 euxassay_012888_13 euxassay_012888_14
EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945
euxassay_012888_15 euxassay_012888_16 euxassay_012888_17 euxassay_012888_18 euxassay_012888_19
EMAGE:8945 EMAGE:8945 EMAGE:8945 EMAGE:8945
euxassay_012888_20 euxassay_012888_21 euxassay_012888_22 euxassay_012888_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8945Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8945_wholemount_strong.wlz
8945_wholemount_moderate.wlz
8945_wholemount_weak.wlz
8945_wholemount_possible.wlz
8945_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8945_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 02 03 04 05 17 18 19 20 21
humerus
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 04 21 22 23
femur
weak weak
regionalweak expression: see section 01 02 03 04 16 17 18 19 20
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15
ventral grey horn
weak weak
regionalweak expression: see section 06 08 09 10 11 12 13
meckel's cartilage
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 14 15 16 17 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 07 14 15 16 weak expression: see section 08 12 13
basioccipital bone
weak weak
regionalweak expression: see section 11 12 13 14 15
basisphenoid bone
weak weak
regionalweak expression: see section 11 12 13 14
exoccipital bone
weak weak
regionalweak expression: see section 04 06
temporal bone
weak weak
regionalweak expression: see section 03
vault of skull
weak weak
regionalweak expression: see section 01 02 03 04
orbito-sphenoid
weak weak
regionalweak expression: see section 01 02 03 04 06 07 08
scapula
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 04 20
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38641
Entity Detected:Zcchc3, zinc finger, CCHC domain containing 3 ( MGI:1915167)
Sequence:sense strand is shown

>T38641
GAAAAGCTAGCCCTGTTTCTCCGCGTCTACGAGGAGAAGCGAGAGCTGGAGGACTGCTGGGAGAACTTTG
TGGTTTTGGGGCGGAGCAGGTCCAGCCTGAAGACCCTCTTCATCCTCTTCCGGAACGAGACCGTGGACGT
GGAGGACATCGTGACCTGGCTCAAGCGCCACTGCGACGTGCTGGCCGTGCCCGTGAAAGTGACCGACAGG
TTCGGGATCTGGACCGGGGAGTACAAGTGCGAGATCGAGCTGCGCCAGGGGGAGGGCGGAGTGAGGCACC
TGCCCGGGGCCTTCTTCTTGGGAGCGGAGAGGGGCTACAGCTGGTACAAGGGGCAGCCCAAGACGTGCTT
TAAGTGTGGTTCCCGGACCCACATGAGCGGCACCTGCACGCAGGACAGGTGTTTCAGGTGCGGGGAAGAG
GGGCACCTGAGCCCTTACTGCCGGAAGGTCATCGTGTGCAACCTCTGTGGCAAAAGAGGACACGCCTTTG
CCCAGTGTCCCAAAGCAGTTCACAATTCCGTGACAGCTCAGCTCACCAGCGTGGCGGGGCACTGAAGGCG
CGACTGCCTGCCAGGGTGAATACACTGCCAGCTTAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 143490. Forward Primer - name:143490_F_cDNA_Zcchc3, sequence:GAAAAGCTAGCCCTGTTTCTCC; Reverse Primer - name:143490_N_SP6_cDNA_Zcchc3, sequence:GTAAGCTGGCAGTGTATTCACCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8940 same embryo
 EMAGE:8941 same embryo
 EMAGE:8942 same embryo
 EMAGE:8943 same embryo
 EMAGE:8944 same embryo
 EurExpress:euxassay_012888 same experiment
 MGI:4829274 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS