Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:991

Pax6 paired box gene 6 ( MGI:97490)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:991 EMAGE:991
Figure 6E of Liu et al., 1999 [PMID:10518499] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 6A of Liu et al., 1999 [PMID:10518499] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Roughly corresponding dark- and bright-field images are shown. Image annotations: In (E) The red arrow points to the caudal boundary of the expression domain of Pax6. In (A): Tel - telencephalon, Di - diencephalon, Mes - mesencephalon, Met - metencephalon, Mye - myelencephalon.
Expression Pattern Description
Spatial Annotation:
EMAGE:991EMAGE:991Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
991_voxel_strong_3D_1.wlz
991_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:991_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
future midbrain
detected detected
regionalThere is a caudal region where there is no expression.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1346823
Entity Detected:Pax6, paired box gene 6 ( MGI:97490)
Notes:The Pax6 probe used in this study by Liu et al., 1999 [PMID:10518499] was previously described by Grindley et al., 1997 [PMID:9232602] as follows "a gene-specific 1 kb template for making Pax6 RNA probe was made by polymerase chain reaction (PCR) amplification, from a 1.6kb cDNA clone, pm1 (Ton et al., 1991 [PMID:1684738] ), using oligonucleotide C128 (ATGGTTTTCTAATCGAAGGG) from the 3' end of the Pax6 homeobox, and a T7 promoter oligonucleotide (AATACGACTCACTATAG) matching vector sequence." Ton et al do not report the specific sequence of pm1 therefore probe end points are undefined.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:Swiss Webster
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
Staining procedure:autoradiography
General Information
Authors:Liu et al., 1999 [PMID:10518499] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10518499] Liu A, Losos K, Joyner AL 1999 FGF8 can activate Gbx2 and transform regions of the rostral mouse brain into a hindbrain fate. Development (126):4827-38
 [ doi:10.1016/S0925-4773(97)00055-5] [ PMID:9232602] Grindley JC, Hargett LK, Hill RE, Ross A, Hogan BL 1997 Disruption of PAX6 function in mice homozygous for the Pax6Sey-1Neu mutation produces abnormalities in the early development and regionalization of the diencephalon. Mech Dev (64):111-26
 [ doi:10.1016/0092-8674(91)90284-6] [ PMID:1684738] Ton CC, Hirvonen H, Miwa H, Weil MM, Monaghan P, Jordan T, van Heyningen V, Hastie ND, Meijers-Heijboer H, Drechsler M 1991 Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. Cell (67):1059-74
Links:MGI:1349184 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI