Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9939

Steap3 STEAP family member 3 ( MGI:1915678)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9939 EMAGE:9939 EMAGE:9939 EMAGE:9939 EMAGE:9939
"Pseudo-wholemount" of euxassay_008169. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008169_01 euxassay_008169_02 euxassay_008169_03 euxassay_008169_04
EMAGE:9939 EMAGE:9939 EMAGE:9939 EMAGE:9939 EMAGE:9939
euxassay_008169_05 euxassay_008169_06 euxassay_008169_07 euxassay_008169_08 euxassay_008169_09
EMAGE:9939 EMAGE:9939 EMAGE:9939 EMAGE:9939 EMAGE:9939
euxassay_008169_10 euxassay_008169_11 euxassay_008169_12 euxassay_008169_13 euxassay_008169_14
EMAGE:9939 EMAGE:9939 EMAGE:9939 EMAGE:9939 EMAGE:9939
euxassay_008169_15 euxassay_008169_16 euxassay_008169_17 euxassay_008169_18 euxassay_008169_19
EMAGE:9939
euxassay_008169_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9939Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9939_wholemount_strong.wlz
9939_wholemount_moderate.wlz
9939_wholemount_weak.wlz
9939_wholemount_possible.wlz
9939_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9939_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 04 05 06 07 08 moderate expression: see section 09 10 11 weak expression: see section 03
humerus
strong strong
regionalstrong expression: see section 01 02 03 04
femur
strong strong
regionalstrong expression: see section 07 08 09
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 09 10
trigeminal v ganglion
strong strong
regionalstrong expression: see section 08
dorsal root ganglion
strong strong
single cellstrong expression: see section 09 11 12 13 14 15 16 17 19 20
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 13 18 19 moderate expression: see section 10 11 12 14 20
maxilla
strong strong
regionalstrong expression: see section 06 07 08 09 13 18 19 moderate expression: see section 10 11 12 14 20
liver left lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13
liver right lobe
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20
basisphenoid bone
strong strong
regionalstrong expression: see section 14 15 16 17
vault of skull
strong strong
regionalstrong expression: see section 01 02
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07
clavicle
strong strong
regionalstrong expression: see section 12 13 18 19 20 moderate expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T250
Entity Detected:Steap3, STEAP family member 3 ( MGI:1915678)
Sequence:sense strand is shown

>T250
GGCTCCTCCAAGCGGCCGGCTGCCGAGGCACTGCTATGTCGGGGGAGATGGACAAGCCGCTGATCAGCCG
CCGCCTAGTGGACAGTGATGGCAGTCTGGCTGAGGTCCCCAAGGAGGCCCCCAAAGTGGGCATCCTGGGC
AGTGGGGATTTTGCCCGTTCCCTGGCCACACGCCTGGTGGGCTCTGGCTTCAGTGTGGTGGTGGGGAGCC
GTAACCCCAAACGCACGGCTGGCCTCTTCCCCTCCTTAGCTCAAGTGACTTTCCAGGAGGAAGCCGTGAG
CTCTCCAGAGGTCATCTTTGTGGCCGTGTTCCGGGAGCACTATTCCTCTCTGTGCAGTCTCGCTGACCAG
TTGGCTGGCAAGATCCTCGTGGATGTAAGCAACCCCACGGAGAAGGAGCATCTTCAGCACCGCCAGTCTA
ACGCTGAGTACCTGGCCTCACTCTTTCCTGCGTGCACTGTGGTGAAGGCCTTCAACGTCATCTCTGCA
Notes:The probe template was PCR amplified from IMAGE:2651585 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2651585 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9938 same embryo
 EMAGE:9940 same embryo
 EMAGE:9937 same embryo
 EurExpress:euxassay_008169 same experiment
 MGI:4828497 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS