Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20221

Fgf8 fibroblast growth factor 8 ( MGI:99604)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20221 EMAGE:20221 EMAGE:20221 EMAGE:20221 EMAGE:20221
"Pseudo-wholemount" of euxassay_012272. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012272_01 euxassay_012272_02 euxassay_012272_03 euxassay_012272_04
EMAGE:20221 EMAGE:20221 EMAGE:20221 EMAGE:20221 EMAGE:20221
euxassay_012272_05 euxassay_012272_06 euxassay_012272_07 euxassay_012272_08 euxassay_012272_09
EMAGE:20221 EMAGE:20221 EMAGE:20221 EMAGE:20221 EMAGE:20221
euxassay_012272_10 euxassay_012272_11 euxassay_012272_12 euxassay_012272_13 euxassay_012272_14
EMAGE:20221 EMAGE:20221 EMAGE:20221 EMAGE:20221 EMAGE:20221
euxassay_012272_15 euxassay_012272_16 euxassay_012272_17 euxassay_012272_18 euxassay_012272_19
EMAGE:20221 EMAGE:20221 EMAGE:20221
euxassay_012272_20 euxassay_012272_21 euxassay_012272_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20221Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20221_wholemount_strong.wlz
20221_wholemount_moderate.wlz
20221_wholemount_weak.wlz
20221_wholemount_possible.wlz
20221_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20221_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 11 13 14 weak expression: see section 12
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 11
thalamus mantle layer
strong strong
regionalstrong expression: see section 09 11
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 weak expression: see section 12
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 13 14 15 weak expression: see section 11 12
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 weak expression: see section 06 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30430
Entity Detected:Fgf8, fibroblast growth factor 8 ( MGI:99604)
Sequence:sense strand is shown

>T30430
CAGGTCCTGGCCAACAAGCGCATCAACGCCATGGCAGAAGACGGAGACCCCTTCGCGAAGCTCATTGTGG
AGACCGATACTTTTGGAAGCAGAGTCCGAGTTCGCGGCGCAGAGACAGGTCTCTACATCTGCATGAACAA
GAAGGGGAAGCTAATTGCCAAGAGCAACGGCAAAGGCAAGGACTGCGTATTCACAGAGATCGTGCTGGAG
AACAACTACACGGCGCTGCAGAACGCCAAGTACGAGGGCTGGTACATGGCCTTTACCCGCAAGGGCCGGC
CCCGCAAGGGCTCCAAGACGCGCCAGCATCAGCGCGAGGTGCACTTCATGAAGCGCCTGCCGCGGGGCCA
CCACACCACCGAGCAGAGCCTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGC
AGCCAGAGGACTTGGGCCCCGGAGCCCCGATAGGCGCTCGCCCAGCTCCTCCCCACCCAGCCGGCCGAGG
AATCCAGCGGGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6513131), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58664. Forward Primer - name:058664_F_IRAV105_b09_Fgf8, sequence:CAGGTCCTGGCCAACAAG; Reverse Primer - name:058664_R_SP6_IRAV105_b09_Fgf8, sequence:AGCTCCCGCTGGATTCCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20226 same embryo
 EMAGE:20223 same embryo
 EMAGE:20222 same embryo
 EMAGE:20225 same embryo
 EMAGE:20224 same embryo
 EurExpress:euxassay_012272 same experiment
 MGI:4824844 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS