Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10078

Arntl aryl hydrocarbon receptor nuclear translocator-like ( MGI:1096381)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078
"Pseudo-wholemount" of euxassay_000108. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000108_01 euxassay_000108_02 euxassay_000108_03 euxassay_000108_04
EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078
euxassay_000108_05 euxassay_000108_06 euxassay_000108_07 euxassay_000108_08 euxassay_000108_09
EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078
euxassay_000108_10 euxassay_000108_11 euxassay_000108_12 euxassay_000108_13 euxassay_000108_14
EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078
euxassay_000108_15 euxassay_000108_16 euxassay_000108_17 euxassay_000108_18 euxassay_000108_19
EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078 EMAGE:10078
euxassay_000108_20 euxassay_000108_21 euxassay_000108_22 euxassay_000108_23 euxassay_000108_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10078Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10078_wholemount_strong.wlz
10078_wholemount_moderate.wlz
10078_wholemount_weak.wlz
10078_wholemount_possible.wlz
10078_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10078_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hemolymphoid system
weak weak
regionalweak expression: see section 16
spleen primordium
weak weak
homogeneousweak expression: see section 11 12
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 16 17 18
pituitary gland
moderate moderate
homogeneousmoderate expression: see section 14 weak expression: see section 11 12 16 17
thalamus
strong strong
regionalstrong expression: see section 09 moderate expression: see section 10 weak expression: see section 16 17 18 19
retina
strong strong
regionalstrong expression: see section 01 02 03 23 24
neural retina
strong strong
regionalstrong expression: see section 01 02 03 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1493
Entity Detected:Arntl, aryl hydrocarbon receptor nuclear translocator-like ( MGI:1096381)
Sequence:sense strand is shown

>T1493
TTTTTTTTTTTTTTATAGAACAAGGGAAACATTTATTAAAAATATTTAACTGTCTAATACATTATACTTT
AACCCATATTTATAGTAAAGGATTCTTACAAGGAAGAATAAACAGCTTTATGATACAATTAGTATAAGAA
ATATCCACATGGGGGACTTCTTTGTAGTGTAAAAACACCATACATCTGAAATGACCATTTTGCATATAAA
AGCTACCAATGATGCTTCTGTGCACAATGATTAAAAAATTCAACACAAACAAAATCCAAAATATACAATT
AATGCAAGCTATCCACAGCTAGCCCAAACTCAATGATGAGGAAACACTGGAGCAGGTTTAGTTCCACTTT
GTCTGAAGTTACACATGGTAGATTGACTTGTATCAATGGCTCTGAGGTGGCTTTTATGGAGTCAGTACAT
AAAAGCTGTTCTCTCTCTATCCAGTAAGCTTCACAGACTGTAAAACTTCACCATTAATGCACTTTGATA
Notes:The probe template was PCR amplified from IMAGE:537975 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:537975 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10077 same embryo
 EurExpress:euxassay_000108 same experiment
 MGI:4823252 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS