Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10102

Tmem17 transmembrane protein 17 ( MGI:2144205)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102
euxassay_000123_01 euxassay_000123_02 euxassay_000123_03 euxassay_000123_04 euxassay_000123_05
EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102
euxassay_000123_06 euxassay_000123_07 euxassay_000123_08 euxassay_000123_09 euxassay_000123_10
EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102
euxassay_000123_11 euxassay_000123_12 euxassay_000123_13 euxassay_000123_14 euxassay_000123_15
EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102
euxassay_000123_16 euxassay_000123_17 euxassay_000123_18 euxassay_000123_19 euxassay_000123_20
EMAGE:10102 EMAGE:10102 EMAGE:10102 EMAGE:10102
euxassay_000123_21 euxassay_000123_22 euxassay_000123_23 euxassay_000123_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10102Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10102_wholemount_strong.wlz
10102_wholemount_moderate.wlz
10102_wholemount_weak.wlz
10102_wholemount_possible.wlz
10102_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10102_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1597
Entity Detected:Tmem17, transmembrane protein 17 ( MGI:2144205)
Sequence:sense strand is shown

>T1597
CTATAATATTTCTGATTATAATCTGTGACAAGAAATGTATGGCACTTCAGACGAAATTGCTTTGTTCAGT
GGAATCTCACCAAGTGTGACAACACCCTCCAGGCACATGTCCTAGCTCAGGGGGAGTCAGCTAATATAAA
ATGAACTCCGTGGTATTCTTGTGGACTTTTTGTTTTATTTTGCTTTGGTTTTGGCATTTCTGTCTTATTA
TTAAAGAGTAAAAAGATGAGATGGAGTTGGGAAAGGGGAAAACATGAAAAATATATGGTATGAAGAAAAG
AATTAATAGAAGGCCATAAAACATAAGCTATTGATATTAAAATATCCACAACATGTAAAAAAAAAAAAAA
A
Notes:The probe template was PCR amplified from IMAGE:991577 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:991577 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10100 same embryo
 EMAGE:10099 same embryo
 EMAGE:10103 same embryo
 EMAGE:10101 same embryo
 EurExpress:euxassay_000123 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS