Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10103

Tnfrsf19 tumor necrosis factor receptor superfamily, member 19 ( MGI:1352474)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103
"Pseudo-wholemount" of euxassay_000124. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000124_01 euxassay_000124_02 euxassay_000124_03 euxassay_000124_04
EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103
euxassay_000124_05 euxassay_000124_06 euxassay_000124_07 euxassay_000124_08 euxassay_000124_09
EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103
euxassay_000124_10 euxassay_000124_11 euxassay_000124_12 euxassay_000124_13 euxassay_000124_14
EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103
euxassay_000124_15 euxassay_000124_16 euxassay_000124_17 euxassay_000124_18 euxassay_000124_19
EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103 EMAGE:10103
euxassay_000124_20 euxassay_000124_21 euxassay_000124_22 euxassay_000124_23 euxassay_000124_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10103Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10103_wholemount_strong.wlz
10103_wholemount_moderate.wlz
10103_wholemount_weak.wlz
10103_wholemount_possible.wlz
10103_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10103_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
spleen primordium
strong strong
homogeneousstrong expression: see section 23 moderate expression: see section 07 22 weak expression: see section 08
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 17
submandibular gland primordium epithelium
moderate moderate
regionalmoderate expression: see section 06 07 17 weak expression: see section 08
vibrissa
strong strong
regionalstrong expression: see section 21 22 moderate expression: see section 23
cerebral cortex
strong strong
regionalstrong expression: see section 02 03 05 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 moderate expression: see section 06 weak expression: see section 04
pinna cartilage condensation
strong strong
regionalstrong expression: see section 01 23 24
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 22
perioptic mesenchyme
moderate moderate
regionalmoderate expression: see section 23
heart
moderate moderate
single cellmoderate expression: see section 07 08 weak expression: see section 10
mandible
strong strong
regionalstrong expression: see section 06 07 18 19 moderate expression: see section 09 10 17 22 weak expression: see section 01 02 03 04 05 08
lower jaw mesenchyme
strong strong
regionalstrong expression: see section 06 07 18 19 moderate expression: see section 09 10 11 17 20 22 23 weak expression: see section 04 05 08
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 15
upper jaw skeleton
weak weak
regionalweak expression: see section 05
maxilla
strong strong
regionalstrong expression: see section 18 moderate expression: see section 21 22 23 weak expression: see section 01 02 03 04 08
upper jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 20
palatal shelf
strong strong
regionalstrong expression: see section 06 07 19 moderate expression: see section 09 17 20 21
premaxilla
strong strong
regionalstrong expression: see section 06 07 18 19 moderate expression: see section 04 09 17 20 21 23 weak expression: see section 08
primary palate
moderate moderate
regionalmoderate expression: see section 09 17 weak expression: see section 05 08
upper jaw incisor
strong strong
regionalstrong expression: see section 16 moderate expression: see section 11 12 15
lung
strong strong
spottedstrong expression: see section 06 07 moderate expression: see section 03 04 05 08 09 10 21 22 23
right lung mesenchyme
strong strong
regionalstrong expression: see section 13
main bronchus
strong strong
regionalstrong expression: see section 13 moderate expression: see section 20
main bronchus mesenchyme
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 moderate expression: see section 21
main bronchus epithelium
strong strong
regionalstrong expression: see section 11 14 15 16 17 18 moderate expression: see section 21
trachea mesenchyme
strong strong
regionalstrong expression: see section 12
frontal bone primordium
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 04
facial bone primordium
moderate moderate
regionalmoderate expression: see section 01
optic foramen
moderate moderate
regionalmoderate expression: see section 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1544
Entity Detected:Tnfrsf19, tumor necrosis factor receptor superfamily, member 19 ( MGI:1352474)
Sequence:sense strand is shown

>T1544
ATCCTGAACTCACTGGAGAAGATACCAATTCCCTCAATCCCGAAAACGAAAGCGCAGCATCTCTGGATTC
CAGTGGCGGCCAGGATCTGGCTGGGACAGCTGCTCTAGAGTCTTCTGGGAATGTTTCAGAATCTACTGAC
TCACCTAGACATGGTGACACTGGTACAGTCTGGGAGCAGACGCTAGCTCAGGATGCTCAAAGGACTCCAA
GCCAAGGAGGCTGGGAAGACAGGGAAAACCTGAATCTAGCCATGCCCACAGCCTTCCAGGATGCCTGAAG
GCCATCTTCCTGACGTGGAGGTGTGGGTCTGGACAAGCCTGTGATGAGGCCTACAGACTGAGCAGTCTTG
GTGTCTGGAAGCAAAAATAAATCTGAACCAAACTGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:835418 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:835418 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10100 same embryo
 EMAGE:10099 same embryo
 EMAGE:10102 same embryo
 EMAGE:10101 same embryo
 EurExpress:euxassay_000124 same experiment
 MGI:4828845 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS