Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10185

Mmp17 matrix metallopeptidase 17 ( MGI:1346076)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10185 EMAGE:10185 EMAGE:10185 EMAGE:10185 EMAGE:10185
"Pseudo-wholemount" of euxassay_000007. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000007_01 euxassay_000007_02 euxassay_000007_03 euxassay_000007_04
EMAGE:10185 EMAGE:10185 EMAGE:10185 EMAGE:10185 EMAGE:10185
euxassay_000007_05 euxassay_000007_06 euxassay_000007_07 euxassay_000007_08 euxassay_000007_09
EMAGE:10185 EMAGE:10185 EMAGE:10185 EMAGE:10185 EMAGE:10185
euxassay_000007_10 euxassay_000007_11 euxassay_000007_12 euxassay_000007_13 euxassay_000007_14
EMAGE:10185 EMAGE:10185 EMAGE:10185 EMAGE:10185 EMAGE:10185
euxassay_000007_15 euxassay_000007_16 euxassay_000007_17 euxassay_000007_18 euxassay_000007_19
EMAGE:10185 EMAGE:10185
euxassay_000007_20 euxassay_000007_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10185Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10185_wholemount_strong.wlz
10185_wholemount_moderate.wlz
10185_wholemount_weak.wlz
10185_wholemount_possible.wlz
10185_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10185_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
caudate-putamen
weak weak
regionalweak expression: see section 09 10 11
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 14 weak expression: see section 15
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 14
thalamus mantle layer
moderate moderate
homogeneousmoderate expression: see section 11 weak expression: see section 15
thalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 13
cerebral cortex mantle layer
strong strong
homogeneousstrong expression: see section 21 moderate expression: see section 01 02 03 04 06 07 08 09 17 18 19 20 weak expression: see section 10 11 16
lentiform nucleus
weak weak
regionalweak expression: see section 08 09 10 11 16 17
telencephalic part of interventricular foramen
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 12 16
medulla oblongata alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 17
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 07 11 14 17
metencephalon rest of alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08
midbrain ventricular layer
weak weak
homogeneousweak expression: see section 11 12 14 15
tegmentum
moderate moderate
single cellmoderate expression: see section 11 14
basal columns
moderate moderate
single cellmoderate expression: see section 09 11 12
intermediate grey horn
moderate moderate
single cellmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2195
Entity Detected:Mmp17, matrix metallopeptidase 17 ( MGI:1346076)
Sequence:sense strand is shown

>T2195
CCCACCTGTCAGACTAGGCAGGACAGAGTCAGGGGTAGGGGCATCTGAGGTTTCCCTGTCTTGGAAGCCA
CCCTACTCTGCCCTCATATCAAAGCACGCTCCTATGATGTCCCATGTTGTCCACCAGCCTGCAGGACACA
GATGTCCTATACAGCAACAGGGAAGGGTCCAAAAATCTTTGTCACATAGCACTGAAAGCCAGGCCCGCAG
GCTGGAGCTGTCTAGATGCTGGTGTCACACTCATTTTAAAACCCAAACTCTTAATAAAAATTTTGTACAC
TGGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:904649 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:904649 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10184 same embryo
 EMAGE:10183 same embryo
 EMAGE:10182 same embryo
 EurExpress:euxassay_000007 same experiment
 MGI:4826408 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS