Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10339

Ephb3 Eph receptor B3 ( MGI:104770)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339
"Pseudo-wholemount" of euxassay_018944. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018944_01 euxassay_018944_02 euxassay_018944_03 euxassay_018944_04
EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339
euxassay_018944_05 euxassay_018944_06 euxassay_018944_07 euxassay_018944_08 euxassay_018944_09
EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339
euxassay_018944_10 euxassay_018944_11 euxassay_018944_12 euxassay_018944_13 euxassay_018944_14
EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339
euxassay_018944_15 euxassay_018944_16 euxassay_018944_17 euxassay_018944_18 euxassay_018944_19
EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339 EMAGE:10339
euxassay_018944_20 euxassay_018944_21 euxassay_018944_22 euxassay_018944_23 euxassay_018944_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10339Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10339_wholemount_strong.wlz
10339_wholemount_moderate.wlz
10339_wholemount_weak.wlz
10339_wholemount_possible.wlz
10339_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10339_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 09 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 20 21 22 23 weak expression: see section 10 18 19
vagus x ganglion
weak weak
regionalweak expression: see section 10 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 18 19 20 weak expression: see section 16 17
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50689
Entity Detected:Ephb3, Eph receptor B3 ( MGI:104770)
Sequence:sense strand is shown

>T50689
CCAGGACTGCACAAGGATTCTGACCAGCCAGCTGGACTTTTGGATGCCTGGCCTCTGGCTGTGGCCCAGA
AGATGGAAGTTTGGGGGAGGACCCTAGCTGTGACTTCTCCAGGCCTGTGCTCCCTCCCAGGAAGTGTGCC
CCAAACCTCTTCATATTGAAGATGGATTAGAAGAGGGGGTGATGTCCCCTCCCCAGATGCCTTGGGGCCC
AGGCCTGCCTGCTCTCCAGTGGGGAGTCTTCACAACTCAGATTGGGCTGCGCTTCAGTAATGGACGTCCT
GGTAGGGTCAGGTGGGGATAAGCCTGGGTTCTTCAGGCCCCAGCCCTGGCAGGGGTCTGACCCCACCAGG
TAAGCAGAGAGTACTCCCTCCCCCAGGAAGTGGAGGAGGAGACTCTGGGGATGGGGAGATATGGTGCCCC
ATCCTGAAGCCAGCTGGTACCTCCAGTTTGCACAGGGACTTGATGGGGGCTGAGGGCCCTGCCTACCCTT
GGTGCTGTCATAAAAGGGCAGGCAGGAGCAGGCTGAGAAGCAGCCTGTGCCTCCCAGAGACTGACTCAGA
GAGCCAGAGACTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGAAAGACGGGGG
TGGGGGTATGTATGTGTGTGTTGTGCACATGCTTGCCTGCACAGAGAGCATGAGTGTGTACAAGCTTGGC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CCAGGACTGCACAAGGATTCTGAC; Reverse Primer - name:unspecified, sequence:GCCAAGCTTGTACACACTCATGCT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10340 same embryo
 EMAGE:10342 same embryo
 EMAGE:10343 same embryo
 EMAGE:10344 same embryo
 EMAGE:10341 same embryo
 EurExpress:euxassay_018944 same experiment
 MGI:4824591 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS