Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10344

Ephb1 Eph receptor B1 ( MGI:1096337)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344
"Pseudo-wholemount" of euxassay_018955. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018955_01 euxassay_018955_02 euxassay_018955_03 euxassay_018955_04
EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344
euxassay_018955_05 euxassay_018955_06 euxassay_018955_07 euxassay_018955_08 euxassay_018955_09
EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344
euxassay_018955_10 euxassay_018955_11 euxassay_018955_12 euxassay_018955_13 euxassay_018955_14
EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344
euxassay_018955_15 euxassay_018955_16 euxassay_018955_17 euxassay_018955_18 euxassay_018955_19
EMAGE:10344 EMAGE:10344 EMAGE:10344 EMAGE:10344
euxassay_018955_20 euxassay_018955_21 euxassay_018955_22 euxassay_018955_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10344Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10344_wholemount_strong.wlz
10344_wholemount_moderate.wlz
10344_wholemount_weak.wlz
10344_wholemount_possible.wlz
10344_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10344_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 04
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 17 18 19
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 03 04 06 07 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 21 22 weak expression: see section 04 20 23
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 10 11 21 22 weak expression: see section 08 09 16 17 18 19 20
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 17 18 weak expression: see section 10
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 05 06 07 18 19 20 21 22
pons mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 17 weak expression: see section 19
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 17 18 weak expression: see section 12 13 15 16 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 15 weak expression: see section 11 17 18 19 20
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 13
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 15 16 17 18
spinal cord floor plate
weak weak
regionalweak expression: see section 15
neural retina
weak weak
regionalweak expression: see section 01 02 03
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50371
Entity Detected:Ephb1, Eph receptor B1 ( MGI:1096337)
Sequence:sense strand is shown

>T50371
ATCCATCTCCCTTTGCTCATGACTCATGTAGGGAAGTTTCTTCAAATAAAGCCCAGCTCCTGAGTCTCCA
GATGTCGTCTGTCAGTTGCCAAAGGACTTTGCTGACCACTACTGCATGGGGATCCAACCAATTCAATTAA
TGTCTTCATATTGAAGAAGAGATGTACCTTCAATTGAAAACCTTGTTTTTCTTTTGTTTGCATTTTCTGC
AAAAAGGAAAAAAAAAAAGAAACCACAAATTGGAAAAAAAATAGAAAAACCTGTTTCCGTGTGCAAACGC
ACACGTATGTGTGTCTGCGTTATAAAATGACTGTGCTTGTTCGTGACAGATGCAAACAAGAAAAAAGAAT
TGGGAAAGGTTTTTGGCCCTGGGAGGTCTCAAGGGGCTGGAATATGCTGTTGGCCTGGCTCTCTGCTTGG
CCCGCTGGGAAGAGAAAAGGGGGAGGGATGATCGTAAATGAAAGAAAAAAAAGTCTCTGAAGAGTTTGCA
AATTAAGACAGGAAACAGGTGAGTGGTTTGAATTGGGT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ATCCATCTCCCTTTGCTCATGACT; Reverse Primer - name:unspecified, sequence:ACCCAATTCAAACCACTCACCTGT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10339 same embryo
 EMAGE:10340 same embryo
 EMAGE:10342 same embryo
 EMAGE:10343 same embryo
 EMAGE:10341 same embryo
 EurExpress:euxassay_018955 same experiment
 MGI:4824589 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS