Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10508

Rarb retinoic acid receptor, beta ( MGI:97857)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508
"Pseudo-wholemount" of euxassay_000777. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000777_01 euxassay_000777_02 euxassay_000777_03 euxassay_000777_04
EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508
euxassay_000777_05 euxassay_000777_06 euxassay_000777_07 euxassay_000777_08 euxassay_000777_09
EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508
euxassay_000777_10 euxassay_000777_11 euxassay_000777_12 euxassay_000777_13 euxassay_000777_14
EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508
euxassay_000777_15 euxassay_000777_16 euxassay_000777_17 euxassay_000777_18 euxassay_000777_19
EMAGE:10508 EMAGE:10508 EMAGE:10508 EMAGE:10508
euxassay_000777_20 euxassay_000777_21 euxassay_000777_22 euxassay_000777_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10508Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10508_wholemount_strong.wlz
10508_wholemount_moderate.wlz
10508_wholemount_weak.wlz
10508_wholemount_possible.wlz
10508_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10508_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 22 23
foregut-midgut junction
weak weak
regionalweak expression: see section 11 12 13 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 16 17 18 19 20
dorsal grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
nasal capsule
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
not examined not examined
regionalnot examined expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
esophagus
weak weak
regionalweak expression: see section 13 14 15
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09
hindgut
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
midgut
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 12 13 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 16 17 18 19 20 weak expression: see section 05 07 08 09
upper jaw incisor
weak weak
regionalweak expression: see section 10 11 12 13 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 18 19 20 weak expression: see section 05 06 08 09
bladder
weak weak
regionalweak expression: see section 11 12 13 14 15
kidney calyx
weak weak
regionalweak expression: see section 07 08 09 10 17 18 19 20 21 not examined expression: see section 01
urethra of male
weak weak
regionalweak expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1016
Entity Detected:Rarb, retinoic acid receptor, beta ( MGI:97857)
Sequence:sense strand is shown

>T1016
TCCTCGAGNCTGTTGGCCTACTGGAGAGTTGATTGAGTTCGTGGACTTTTCTGTGCGGCTCGCCTCCACA
CCTAGAGGATAAGCACTTTTGCAGAGCGCGGTGCGGAGAGATCATGTTTGACTGTATGGATGTTCTGTCA
GTGAGTCCCGGGCAGATCCTGGATTTCTACACCGCGAGCCCTTCCTCCTGCATGCTGCAGGAAAAGGCTC
TCAAAGCCTGCCTCAGTGGATTCACCCAGGCCGAATGGCAGCACCGGCATACTGCTCAATCCATCGAGAC
ACAGAGTACCAGCTCTGAGGAGCTCGTCCCGAGCCCACCATCTCCACTTCCTCCTCCTCGGGTGTACAAG
CCCTGCTTCGTTTGCCAGGACAAGTCATCGGGCTACCACTATGGCGTCAGTGCCTGCGAGGGGTGCAAGG
GCTTTTTCCGCAGAAGTATTCAGAAGAACATGATCTACACTTGCCATCGAGATAAGAACTGCGTCATTAA
CAAGGTCACTAGGAACCGATGCCAGTACTGCCGCCTGCAGAAGTGCTTTGAAGTGGGCATGTCCAAAGAG
TCT
Notes:The probe template was PCR amplified from IMAGE:2065364 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2065364 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10509 same embryo
 EMAGE:10511 same embryo
 EMAGE:10510 same embryo
 EurExpress:euxassay_000777 same experiment
 MGI:4827616 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS