Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10599

Tbx15 T-box 15 ( MGI:1277234)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599
"Pseudo-wholemount" of euxassay_000953. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000953_01 euxassay_000953_02 euxassay_000953_03 euxassay_000953_04
EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599
euxassay_000953_05 euxassay_000953_06 euxassay_000953_07 euxassay_000953_08 euxassay_000953_09
EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599
euxassay_000953_10 euxassay_000953_11 euxassay_000953_12 euxassay_000953_13 euxassay_000953_14
EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599
euxassay_000953_15 euxassay_000953_16 euxassay_000953_17 euxassay_000953_18 euxassay_000953_19
EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599 EMAGE:10599
euxassay_000953_20 euxassay_000953_21 euxassay_000953_22 euxassay_000953_23 euxassay_000953_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10599Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10599_wholemount_strong.wlz
10599_wholemount_moderate.wlz
10599_wholemount_weak.wlz
10599_wholemount_possible.wlz
10599_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10599_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 05 06 21 moderate expression: see section 03 04 07 08 19 20 weak expression: see section 09 10 11
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
dermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 19 20 21 22 23 24
not examined not examined
regionalnot examined expression: see section 01 02 03 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T415
Entity Detected:Tbx15, T-box 15 ( MGI:1277234)
Sequence:sense strand is shown

>T415
CTGACCTTTGAGGACTTCACTACCATGCAAAAGCAGCAAGGGGGCAGTACAGGTACTTCTCCAACCACCT
CCAGCACTGGGACACCATCCCCTTCGGCTTCTTCTCATCTCTTATCTCCATCTTGTTCTCCTCCAACTTT
TCATTTGGCCCCGAATACTTTCAATGTGGGCTGTCGAGAAAGCCAGCTGTGTAATCTAAACCTCTCTGAT
TATCCACCATGTGCCCGAAGCAACATGGCTGCCTTACAGAGCTATCCAGGGCTGAGTGACAGTGGCTACA
ACCGGCTCCAGAGTGGCACAGCTTCAGCCACTCAGCCCTCTGAAACCTTCATGCCTCAGAGGACTCCATC
TCTGATCTCAGGAATACCAACACCTCCCTCGTTGCCCAGCAACAGCAAGATGGAAGCCTATGGTGGCCAG
TTGGGGTCCTTCCCCACTTCCCAGTTTCAGTATGTCATGCAGGCAGGCAATGCAGCCTCCAGTTCCTCAT
CGCCACACATG
Notes:The probe template was PCR amplified from IMAGE:3157744 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3157744 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10600 same embryo
 EMAGE:10601 same embryo
 EurExpress:euxassay_000953 same experiment
 MGI:4828621 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS