Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10645

Echdc1 enoyl Coenzyme A hydratase domain containing 1 ( MGI:1277169)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10645 EMAGE:10645 EMAGE:10645 EMAGE:10645 EMAGE:10645
"Pseudo-wholemount" of euxassay_003212. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003212_01 euxassay_003212_02 euxassay_003212_03 euxassay_003212_04
EMAGE:10645 EMAGE:10645 EMAGE:10645 EMAGE:10645 EMAGE:10645
euxassay_003212_05 euxassay_003212_06 euxassay_003212_07 euxassay_003212_08 euxassay_003212_09
EMAGE:10645 EMAGE:10645 EMAGE:10645 EMAGE:10645 EMAGE:10645
euxassay_003212_10 euxassay_003212_11 euxassay_003212_12 euxassay_003212_13 euxassay_003212_14
EMAGE:10645 EMAGE:10645 EMAGE:10645 EMAGE:10645 EMAGE:10645
euxassay_003212_15 euxassay_003212_16 euxassay_003212_17 euxassay_003212_18 euxassay_003212_19
EMAGE:10645 EMAGE:10645
euxassay_003212_20 euxassay_003212_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10645Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10645_wholemount_strong.wlz
10645_wholemount_moderate.wlz
10645_wholemount_weak.wlz
10645_wholemount_possible.wlz
10645_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10645_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
homogeneousweak expression: see section 12 13 14 15 16
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 10 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1109
Entity Detected:Echdc1, enoyl Coenzyme A hydratase domain containing 1 ( MGI:1277169)
Sequence:sense strand is shown

>T1109
CCTCNAGCCTGTTGGCCTACTGGCTGCACCGCAGCGCAGGCGCCGCCGCGCAGGTGGGCTCGTGAGTTCC
TGCAGGTCTCTGGGAAATCCTGAGGCGTTGCAGAGAACGTGGGAAAATCCGCTAAATTGGCAGTTTCAAA
GGATGAGAAGGTGTGAGGTCAATTCTAAGCCGATTTCTGAATATTTTGGAATCCCTTGTGAGAACCGAGA
AATGGCAAAATGTCTTTTGACTTCATCTCTGTCTGTAAGAACAAAACTCTTACAAACAGGAGTGTCGCTT
TATAATACGAGTCATGGCTTCCACGAGGAGGAAGTGAAGAAGATACTGGAGCAGTTTCCTGGTGGATCCA
TTGACCTCCTAAAGAAGCAGAACGGCATTGGCATTCTGACGCTAAACAACCCCAATAAAATGAATGCCTT
CTCAGGTGTCATGATGCTACAACTTTTGGAAAGGGTAATTGAATTAGAAAATTGGACAGAAGGGAAAGGC
CTCATTATCCATGGAGCAAAAAATACTTTCTGCTCAGGATCTGATCTGAATGCTGTGAAGGCACTCTCCA
CTCCAGAAAGTGGAGTGG
Notes:The probe template was PCR amplified from IMAGE:2123700 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2123700 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10644 same embryo
 EMAGE:10643 same embryo
 EMAGE:10646 same embryo
 EMAGE:10647 same embryo
 EurExpress:euxassay_003212 same experiment
 MGI:4824463 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS