Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10877

P4ha2 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide ( MGI:894286)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877
"Pseudo-wholemount" of euxassay_003346. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003346_01 euxassay_003346_02 euxassay_003346_03 euxassay_003346_04
EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877
euxassay_003346_05 euxassay_003346_06 euxassay_003346_07 euxassay_003346_08 euxassay_003346_09
EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877
euxassay_003346_10 euxassay_003346_11 euxassay_003346_12 euxassay_003346_13 euxassay_003346_14
EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877
euxassay_003346_15 euxassay_003346_16 euxassay_003346_17 euxassay_003346_18 euxassay_003346_19
EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877 EMAGE:10877
euxassay_003346_20 euxassay_003346_21 euxassay_003346_22 euxassay_003346_23 euxassay_003346_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10877Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10877_wholemount_strong.wlz
10877_wholemount_moderate.wlz
10877_wholemount_weak.wlz
10877_wholemount_possible.wlz
10877_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10877_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 23 moderate expression: see section 05 21 22 weak expression: see section 03 04 06 07 19 20
pectoral girdle and thoracic body wall musculature
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 moderate expression: see section 08 09 10 17 18 19 20 21 22 23 weak expression: see section 11
lower jaw molar
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 08 09 18 19 21
upper jaw molar
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 08 09 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 10 19 weak expression: see section 08 09 13 14 15 16 17 18
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23 24 weak expression: see section 06 19 21
viscerocranium
weak weak
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 04 09 10 16 17 18 moderate expression: see section 19 weak expression: see section 05 06 07 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6357
Entity Detected:P4ha2, procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide ( MGI:894286)
Sequence:sense strand is shown

>T6357
AGTTGATTGACGTCCTTTTCTCTCCGCTCCTCCCTGGCCCATAGTCCAAATCATCTTCAAGTTCAACATG
ACAGCTTCCTTTTTATGTCCCAGCTCCTGTCAGGCAGGTCATTGGAGGAGCCAGTGTTTGACTGAATTGA
GAGAGTATATCCTGAGCCTAGTCCTGGGTGACCTGGGCCCCAGACTCTGACCAGCTTACACCTGCCCTGG
CTCTGGGGGTGTCTTGGCATGGCTGCGGTAGAGCCAGACTATAGCACCCGGCACGGTGCCTTTGTACCTC
AGATATTTCAGGTAGAAGATGTCTCAGTGAAACCAAAGTTCTGATGCTGTTTACATGTGTGTTTTTATCA
CATTTCTATTTGTTGTGGCTTTAACCCTATAGTGTCACCT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CCAACAAGTGGTTCCATGAG; Reverse Primer - name:unspecified, sequence:GGTTAAAGCCACAACAAATAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10878 same embryo
 EMAGE:10875 same embryo
 EMAGE:10876 same embryo
 EurExpress:euxassay_003346 same experiment
 MGI:4827017 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS