Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10918

Ckmt1 creatine kinase, mitochondrial 1, ubiquitous ( MGI:99441)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918
"Pseudo-wholemount" of euxassay_003595. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003595_01 euxassay_003595_02 euxassay_003595_03 euxassay_003595_04
EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918
euxassay_003595_05 euxassay_003595_06 euxassay_003595_07 euxassay_003595_08 euxassay_003595_09
EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918
euxassay_003595_10 euxassay_003595_11 euxassay_003595_12 euxassay_003595_13 euxassay_003595_14
EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918
euxassay_003595_15 euxassay_003595_16 euxassay_003595_17 euxassay_003595_18 euxassay_003595_19
EMAGE:10918 EMAGE:10918 EMAGE:10918 EMAGE:10918
euxassay_003595_20 euxassay_003595_21 euxassay_003595_22 euxassay_003595_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10918Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10918_wholemount_strong.wlz
10918_wholemount_moderate.wlz
10918_wholemount_weak.wlz
10918_wholemount_possible.wlz
10918_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10918_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 17 weak expression: see section 04 05 06 07 08 09 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 07
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 18 19 20
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 08 09 10 12
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 19 20 21
rectum
moderate moderate
regionalmoderate expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6312
Entity Detected:Ckmt1, creatine kinase, mitochondrial 1, ubiquitous ( MGI:99441)
Sequence:sense strand is shown

>T6312
GCCGCATCCCCAAGCCATGGCTGGTCCCTTCTCCCGTCTGCTGTCTGCCCGCCCTGGACTCAGGCTCCTG
GCTTTGGCTGGAGCTGGGTCTCTCACCGCCGGGATTCTGCTCCGCCCGGAATCTGTAGGAGCTGCCGCTG
CTGAACGGAGGAGACTGTATCCCCCGAGCGCTGAGTACCCAGACCTCCGAAAGCACAACAACTGCATGGC
CAGTCACCTGACCCCAGCAGTCTATGCACGGCTCTGCGACAAGACCACACCCACTGGTTGGACACTAGAT
CAGTGCATCCAGACTGGAGTGGACAACCCTGGCCACCCCTTCATCAAGACTGTGGGCATGGTGGCTGGAG
ATGAGGAGACCTATGAGGTATTTGCTGAACTGTTTGACCCTGTGATCCAAGAGCGGCATAATGGATATGA
CCCCAGAACAATGAAGCACACCACTGACCTTGATGCCAGTAAAATCCGTTCTGGCTACTTTGATGAGAGG
TATGTATTGTCTTCAAGAGTCAGAACTGGCCGAAGTATCAGGGGACTCAGTCTCCCTCCAGCCTGCACTC
GGGCAGAGCGAAGAGAGGTAGAACGTGTTGTGGTGGATGCTCTGAGTGGCCTGAAGGGTGACCTGGCT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ATCTTCCCTCCTAGTTCCTG; Reverse Primer - name:unspecified, sequence:CAAACACTCTCTTCATGTTGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10916 same embryo
 EMAGE:10917 same embryo
 EMAGE:10915 same embryo
 EMAGE:10914 same embryo
 EurExpress:euxassay_003595 same experiment
 MGI:4823890 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS