Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11924

Krt16 keratin 16 ( MGI:96690)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924
"Pseudo-wholemount" of euxassay_011030. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011030_01 euxassay_011030_02 euxassay_011030_03 euxassay_011030_04
EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924
euxassay_011030_05 euxassay_011030_06 euxassay_011030_07 euxassay_011030_08 euxassay_011030_09
EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924
euxassay_011030_10 euxassay_011030_11 euxassay_011030_12 euxassay_011030_13 euxassay_011030_14
EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924
euxassay_011030_15 euxassay_011030_16 euxassay_011030_17 euxassay_011030_18 euxassay_011030_19
EMAGE:11924 EMAGE:11924 EMAGE:11924 EMAGE:11924
euxassay_011030_20 euxassay_011030_21 euxassay_011030_22 euxassay_011030_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11924Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11924_wholemount_strong.wlz
11924_wholemount_moderate.wlz
11924_wholemount_weak.wlz
11924_wholemount_possible.wlz
11924_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11924_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
spottedstrong expression: see section 10 11 13 14 weak expression: see section 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18 19 20
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 21 22 23
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 17 18 20 21 22 23 weak expression: see section 19
cornea epithelium
strong strong
regionalstrong expression: see section 03 04 05 23 moderate expression: see section 01 02
naris
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 12 13 14 16 17 moderate expression: see section 09 10 11 18 19 20
esophagus
strong strong
regionalstrong expression: see section 10 11 12
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 weak expression: see section 08
hindgut
weak weak
regionalweak expression: see section 12 13
rectum
weak weak
regionalweak expression: see section 12 13
midgut
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 14 16 17 18
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 08 09 19 20
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
palatal shelf epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 16 17 18
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 19 20
bladder
strong strong
regionalstrong expression: see section 12 13
urethra of male
strong strong
regionalstrong expression: see section 12 13 14
larynx
strong strong
regionalstrong expression: see section 11 12 13
trachea
moderate moderate
regionalmoderate expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36567
Entity Detected:Krt16, keratin 16 ( MGI:96690)
Sequence:sense strand is shown

>T36567
CCCCTACTTCAAGACCATTGAGGACCTGAAGAGCAAGATCATTATTGCCACCCAGGAGAATGCACAGTTC
ACTTTGCAGATTGACAATGCCAGGCTGGCAGCTGATGACTTCAGGACCAAGTACGAGAATGAGCTGTTCT
TGCGGCAGTCCGTGGAGGGTGACATCAATGGCCTGCGCAAGGTGCTAGATGAGCTGACCCTGTCCAGAGC
TGACCTGGAAATGCAGATTGAAAACCTCAGAGAAGAGCTGGCCTTCCTGAAGAAGAACCATGAGGAGGAG
ATGCTTGCCTTGAGGGGTCAGACTGGTGGGGACGTCAATGTGGAGATGGACGCAGCCCCCGGTGTGGACC
TCAGCCGCATTCTGAATGAGATGAGGGACCAGTATGAGCAGATGGCAGAGAAGAACCGCAGAGATGTGGA
GGCCTGGTTCCTGAGAAAGACTGAGGAGCTGAACAAAGAGGTGGCCTCTAACAGTGATCTAATCCAGAGC
AACCGCAGCGAGGTGGCTGAGCTCCGCAGGGTGTTCCAGGGCCTGGAGATTGAACTGCAGTCCCAGCTCA
GCATGAAAGCATCCTTGGAGAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98024. Forward Primer - name:098024_F_cDNA_Krt1-16, sequence:CCCCTACTTCAAGACCATTGAG; Reverse Primer - name:098024_N_SP6_cDNA_Krt1-16, sequence:GTTCTCCAAGGATGCTTTCAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11925 same embryo
 EMAGE:11928 same embryo
 EMAGE:11927 same embryo
 EMAGE:11923 same embryo
 EMAGE:11926 same embryo
 EurExpress:euxassay_011030 same experiment
 MGI:4825829 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS