Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11952

Map4k4 mitogen-activated protein kinase kinase kinase kinase 4 ( MGI:1349394)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952
"Pseudo-wholemount" of euxassay_011136. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011136_01 euxassay_011136_02 euxassay_011136_03 euxassay_011136_04
EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952
euxassay_011136_05 euxassay_011136_06 euxassay_011136_07 euxassay_011136_08 euxassay_011136_09
EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952
euxassay_011136_10 euxassay_011136_11 euxassay_011136_12 euxassay_011136_13 euxassay_011136_14
EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952
euxassay_011136_15 euxassay_011136_16 euxassay_011136_17 euxassay_011136_18 euxassay_011136_19
EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952 EMAGE:11952
euxassay_011136_20 euxassay_011136_21 euxassay_011136_22 euxassay_011136_23 euxassay_011136_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11952Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11952_wholemount_strong.wlz
11952_wholemount_moderate.wlz
11952_wholemount_weak.wlz
11952_wholemount_possible.wlz
11952_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11952_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
vibrissa
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07 08 09 22 23
telencephalon
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 24
hindbrain
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 17
spinal cord
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09 15
cervical ganglion
weak weak
regionalweak expression: see section 09 16
thoracic ganglion
weak weak
regionalweak expression: see section 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 24
midgut
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 19 20
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36619
Entity Detected:Map4k4, mitogen-activated protein kinase kinase kinase kinase 4 ( MGI:1349394)
Sequence:sense strand is shown

>T36619
CCAGAAACACAAATCTTCCTCCTCCTTTACACCTTTTATAGACCCCAGGTTACTACAGATCTCTCCATCT
AGTGGGACGACAGTGACTTCCGTGGTGGGATTTTCCTGTGATGGGCTGAGACCAGAAGCCATAAGGCAAG
ATCCTACTCGGAAAGGCTCAGTGGTCAATGTGAACCCCACGAACACTAGGCCACAGAGTGATACCCCCGA
GATTCGTAAATACAAGAAGAGATTTAACTCAGAGATCCTGTGTGCTGCCTTATGGGGAGTGAACTTGCTG
GTTGGTACAGAGAGCGGTCTGATGCTCTTGGACAGAAGTGGCCAAGGGAAAGTATACCCTCTGATCAGCC
GAAGACGGTTCCAGCAAATGGATGTGCTCGAAGGCCTAAATGTCCTGGTGACAATATCTGGCAAAAAGGA
TAAGTTACGTGTCTACTATTTATCCTGGCTAAGAAATAAGATTCTTCATAATGATCCAGAGGTTGAGAAG
AAGCAGGGGTGGACCACTGTGGGCGACTTGGAAGGGTGCGTGCACTATAAAGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98209. Forward Primer - name:098209_F_cDNA_Map4k4, sequence:CCAGAAACACAAATCTTCCTCC; Reverse Primer - name:098209_N_SP6_cDNA_Map4k4, sequence:GACTTTATAGTGCACGCACCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11951 same embryo
 EMAGE:11954 same embryo
 EMAGE:11953 same embryo
 EMAGE:11950 same embryo
 EurExpress:euxassay_011136 same experiment
 MGI:4826085 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS