Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11986

Pabpc6 poly(A) binding protein, cytoplasmic 6 ( MGI:1914793)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986
"Pseudo-wholemount" of euxassay_011207. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011207_01 euxassay_011207_02 euxassay_011207_03 euxassay_011207_04
EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986
euxassay_011207_05 euxassay_011207_06 euxassay_011207_07 euxassay_011207_08 euxassay_011207_09
EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986
euxassay_011207_10 euxassay_011207_11 euxassay_011207_12 euxassay_011207_13 euxassay_011207_14
EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986
euxassay_011207_15 euxassay_011207_16 euxassay_011207_17 euxassay_011207_18 euxassay_011207_19
EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986 EMAGE:11986
euxassay_011207_20 euxassay_011207_21 euxassay_011207_22 euxassay_011207_23 euxassay_011207_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11986Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11986_wholemount_strong.wlz
11986_wholemount_moderate.wlz
11986_wholemount_weak.wlz
11986_wholemount_possible.wlz
11986_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11986_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21 22 23 24
thymus primordium
strong strong
homogeneousstrong expression: see section 13 14 15 16 moderate expression: see section 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11 12 16
thyroid gland
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 12
pituitary gland
moderate moderate
regionalmoderate expression: see section 12 13 14 15
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 20 21 weak expression: see section 03 06 07 19 22
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23
midbrain ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17 18 19
naris
weak weak
regionalweak expression: see section 10 11 14 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 17 18 weak expression: see section 08 09 10 11 12 14 15 16
vomeronasal organ
weak weak
regionalweak expression: see section 11 14
esophagus
weak weak
regionalweak expression: see section 13 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 13
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10
hindgut
moderate moderate
regionalmoderate expression: see section 13 14 15
rectum
moderate moderate
regionalmoderate expression: see section 13 14
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 14 15 16 17 18 weak expression: see section 12 13
mandible
weak weak
regionalweak expression: see section 03 04 05 07 08 09 10 11 17 18 19 20 21 22 23 24
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 10 11 12 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 19 20
maxilla
weak weak
regionalweak expression: see section 04 05 07 08 17 18 19 20 21 22
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 10 11 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 19 20
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20 21
urethra of male
weak weak
regionalweak expression: see section 13 14
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37409
Entity Detected:Pabpc6, poly(A) binding protein, cytoplasmic 6 ( MGI:1914793)
Sequence:sense strand is shown

>T37409
TCAGACTACTCAGCAAGGACCAAGTGCCCGTGGGAGTGCTCACGGTACCAGAGCTCATCCATTCCAAAAC
ATGTCTAGTACCATCCACCCATCACATACTATGCCATCATTTAGTACTTCAGGACCCACTACCTCACAGG
CTATACGACATCGTACTGCCAGCACATCCACACAGATGATGGGCCCACATCCTGCAGCTGCTGCTGCTGC
TGCAGCTGCTCCTGCCACCCGCACAATTACCCAGTATAAATATACTGCTGGAGTCCGAAATCCCCCTCAG
CATCCTAATACACAGCCACATGTCAGCACGCAGCGGTCTGCTGTTCCTGTCCAAGGTAAAGAGTCTTTGA
CTGCCTCCATGTTGGCCTCTGCTCCTCCTCAAGCTCAAAAGCAAATGTTAGGGGAATGGCTCTTCTCTCT
TATTCAGGCCATGCACCCTGCCCTTGCTGGTAAAATCACGGGTATGCTGTTGGAAATTGATAATATAGAG
CTACGCCACATGCTTGAGTCTCCAGAGTGTCTCCACACCAAAGTTGATGAAGCCATAGCTGTACTGCAAG
CTCACCAAGCTAAAGAGACTTCACAGAAAGCAGTCAGCAGTGTTGCTGGTGTCCCAAATGCTTAAAGATG
AGCAGGTGAATGCATAAAAACCCCTGCTTCACTGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64925. Forward Primer - name:064925_F_cDNA_4932702K14Rik, sequence:TCAGACTACTCAGCAAGGACCA; Reverse Primer - name:064925_N_SP6_cDNA_4932702K14Rik, sequence:TTCAGTGAAGCAGGGGTTTTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11984 same embryo
 EMAGE:11987 same embryo
 EMAGE:11985 same embryo
 EMAGE:11983 same embryo
 EMAGE:11982 same embryo
 EurExpress:euxassay_011207 same experiment
 MGI:4827019 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS