Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12020

Cyp2j9 cytochrome P450, family 2, subfamily j, polypeptide 9 ( MGI:1921769)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020
"Pseudo-wholemount" of euxassay_009565. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009565_01 euxassay_009565_02 euxassay_009565_03 euxassay_009565_04
EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020
euxassay_009565_05 euxassay_009565_06 euxassay_009565_07 euxassay_009565_08 euxassay_009565_09
EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020
euxassay_009565_10 euxassay_009565_11 euxassay_009565_12 euxassay_009565_13 euxassay_009565_14
EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020
euxassay_009565_15 euxassay_009565_16 euxassay_009565_17 euxassay_009565_18 euxassay_009565_19
EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020 EMAGE:12020
euxassay_009565_20 euxassay_009565_21 euxassay_009565_22 euxassay_009565_23 euxassay_009565_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12020Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12020_wholemount_strong.wlz
12020_wholemount_moderate.wlz
12020_wholemount_weak.wlz
12020_wholemount_possible.wlz
12020_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12020_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14 15
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 15 16 18 19 20 21 22
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16 17 18 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 16 17 weak expression: see section 14 15
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 10 19 20 21 22 23 24
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 10 19 20 21 22 23
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18
nasal cavity olfactory epithelium
moderate moderate
single cellmoderate expression: see section 13 14 15 16 17 18 19 21 22 weak expression: see section 23
esophagus
weak weak
regionalweak expression: see section 14 15
stomach
weak weak
regionalweak expression: see section 11
stomach mesentery
weak weak
regionalweak expression: see section 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36224
Entity Detected:Cyp2j9, cytochrome P450, family 2, subfamily j, polypeptide 9 ( MGI:1921769)
Sequence:sense strand is shown

>T36224
GGATTGATCTTCTCCAGTGACCAGACATGGAAGGAGCAAAGGAGGTTTGCCCTGATGACACTGAGGAACT
TTGGACTAGGAAAGAGGAGCTTAGAGGAACGAATACAAGAGGAGGCTCACTACCTTGTGGAGGCCATAAG
AGATGAGGGAGGACAGCCTTTTGACCCTCACTTCAATATCAGCAATGCAGTTTCCAACATAATTTGCTCT
ATTACCTTTGGGGAGCGCTTTGACTACCATGACAGTCAGTTTCAGGAGATGCTGAGGCTACTGGATGAGG
CCATGTGTTTGGAGTCATCAATGATGTGCCAACTTTACAATATCTTTCCAAGGATACTTCAGTATCTTCC
TGGATCACACCAGACACTTTTCAGAAACTGGAGAAAACTGCAATTGTTTGTTTCCGATATTGTTAACAAT
CACCGGAGAGACTGGGATCCAGATGAGCCGAGAGACTTCATTGATGCTTTCCTCACAGAAATGACAAAGT
ACCCAGACAAGACTACTACAAGTTTCAATGAAGAAAACCTCATCTGCAGCACTCTGGACCTCTTCTTTGC
TGGAACAGAGACAACATCTACAACACTGCGCTGGGCTCTCCTCTGCATGGCCCTCTACCCAGAAGTCCAA
GAAAAAATGCAGGCTGAGATTGACAGAGTGATTGGCCAAGCAAGACAGCCGAATCTGGCAGACCGAGACT
CCATGCCCTACACCAATGCTGTCATCCATGAGGTGCAGAGGATGGGCAACATCATCCCCTTTAACGTTCC
CAGGGAAGTGGCAGTTGACACCCAGTTGGCTGGATTTAACTTGCCAAAGGGTATTATGGTTCTTTCCAAC
CTAACTGCACTGCACAGGGATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91569. Forward Primer - name:091569_F_cDNA_Cyp2j9, sequence:GGATTGATCTTCTCCAGTGACC; Reverse Primer - name:091569_N_SP6_cDNA_Cyp2j9, sequence:GATCCCTGTGCAGTGCAGTTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12021 same embryo
 EurExpress:euxassay_009565 same experiment
 MGI:4824174 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS