Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12023

Grik2 glutamate receptor, ionotropic, kainate 2 (beta 2) ( MGI:95815)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023
"Pseudo-wholemount" of euxassay_008383. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008383_01 euxassay_008383_02 euxassay_008383_03 euxassay_008383_04
EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023
euxassay_008383_05 euxassay_008383_06 euxassay_008383_07 euxassay_008383_08 euxassay_008383_09
EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023
euxassay_008383_10 euxassay_008383_11 euxassay_008383_12 euxassay_008383_13 euxassay_008383_14
EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023
euxassay_008383_15 euxassay_008383_16 euxassay_008383_17 euxassay_008383_18 euxassay_008383_19
EMAGE:12023 EMAGE:12023 EMAGE:12023 EMAGE:12023
euxassay_008383_20 euxassay_008383_21 euxassay_008383_22 euxassay_008383_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12023Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12023_wholemount_strong.wlz
12023_wholemount_moderate.wlz
12023_wholemount_weak.wlz
12023_wholemount_possible.wlz
12023_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12023_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot
moderate moderate
regionalmoderate expression: see section 20 21 weak expression: see section 03 04 05 18 19 22 23
diencephalon
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
pituitary gland
moderate moderate
single cellmoderate expression: see section 12 13 14 16
telencephalon
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
cerebellum
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 05 06 07 20 21 22 23 weak expression: see section 08 09 10
trigeminal v nerve
moderate moderate
single cellmoderate expression: see section 11 18 19
spinal cord
strong strong
single cellstrong expression: see section 09 10 11 12 13 14 15 16 17
tongue
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17
stomach
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11
hindgut
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18 19
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18 19
renal cortex
moderate moderate
regionalmoderate expression: see section 07 16 20 weak expression: see section 08 09 10 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35231
Entity Detected:Grik2, glutamate receptor, ionotropic, kainate 2 (beta 2) ( MGI:95815)
Sequence:sense strand is shown

>T35231
GTGGCGTAAATATGACAGGGTTCAGAATACTAAATACAGAGAATACCCAAGTCTCCTCCATCATCGAGAA
GTGGTCGATGGAACGGTTACAGGCACCTCCAAAACCTGACTCAGGTTTGCTGGATGGATTTATGACGACT
GATGCTGCTCTGATGTATGATGCAGTGCACGTTGTGTCTGTAGCTGTCCAACAGTTTCCCCAGATGACAG
TCAGCTCCTTGCAATGCAATCGACACAAACCCTGGCGCTTTGGGACTCGCTTCATGAGCCTAATTAAAGA
GGCTCATTGGGAAGGTCTTACAGGCAGAATTACATTTAACAAAACCAATGGATTGCGAACAGATTTTGAT
TTGGATGTGATCAGTCTCAAGGAAGAAGGTCTGGAGAAGATTGGGACTTGGGATCCATCCAGTGGCCTGA
ATATGACAGAAAGTCAGAAAGGGAAGCCAGCAAATATTACAGATTCATTGTCTAATCGTTCTTTGATTGT
TACCACCATTTTGGAAGAACCATATGTCCTGTTTAAGAAGTCTGACAAACCTCTCTATGGGAATGATCGA
TTTGAAGGCTACTGTATTGATCTTCTACGAGAGTTATCTACAATCCTTGGCTTTACATATGAAATTAGGC
TTGTGGAGGATGGGAAATATGGAGCCCAGGATGATGTGAATGGACAATGGAATGGAATGGTTCGTGAGCT
AATTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90011. Forward Primer - name:090011_F_cDNA_Grik2, sequence:GTGGCGTAAATATGACAGGGTT; Reverse Primer - name:090011_N_SP6_cDNA_Grik2, sequence:CAATTAGCTCACGAACCATTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12022 same embryo
 EMAGE:12026 same embryo
 EMAGE:12025 same embryo
 EMAGE:12027 same embryo
 EMAGE:12024 same embryo
 EurExpress:euxassay_008383 same experiment
 MGI:4825230 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS