Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12530

Sfrs18 serine/arginine-rich splicing factor 18 ( MGI:1913875)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530
"Pseudo-wholemount" of euxassay_011305. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011305_01 euxassay_011305_02 euxassay_011305_03 euxassay_011305_04
EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530
euxassay_011305_05 euxassay_011305_06 euxassay_011305_07 euxassay_011305_08 euxassay_011305_09
EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530
euxassay_011305_10 euxassay_011305_11 euxassay_011305_12 euxassay_011305_13 euxassay_011305_14
EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530
euxassay_011305_15 euxassay_011305_16 euxassay_011305_17 euxassay_011305_18 euxassay_011305_19
EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530 EMAGE:12530
euxassay_011305_20 euxassay_011305_21 euxassay_011305_22 euxassay_011305_23 euxassay_011305_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12530Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12530_wholemount_strong.wlz
12530_wholemount_moderate.wlz
12530_wholemount_weak.wlz
12530_wholemount_possible.wlz
12530_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12530_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 22 23 24
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 19 20 21 22 23 24
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 09 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 19 20 21 22
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 11 19
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 16 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 17 18 19 20 21
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14 17
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37448
Entity Detected:Sfrs18, serine/arginine-rich splicing factor 18 ( MGI:1913875)
Sequence:sense strand is shown

>T37448
AAGGAAGCGAGAAAGTGAGAGAACTTTCTGTAGGAGTGGTTCTATATCTGTTAAAGTCATAAGACATGAC
TCTAGACAGGATAGTAAGAAAAATGCTACCAAAGATAGTAAAAGGCATTCAGGTTCTGATTCTAGTGGAA
GGAGCAGTTCCGAATCCCCCGGAAGTAGCAAAGAAAAGAAGGCTAAGAAGCCTAAACATAGTCGATCGCG
CTCCCTGGAGAAATCTCAAAGGTCTGGTAAGAAGGCAAGCCGCAAACACAAGTCTAAGTCCCGATCAAGA
TCAACAACCCCTCCCCGTCGTAAGCGCTGAGGAATGATGTGGCAAGAATGCCATGATGCTGTTTTTAAAA
ATTCCATGAGTTTAAGGGCTTGTCTCATTATAGAGGCACATTGTGGCTGTGTAGGTGAAACCAGATTTTT
TTTTTTTATTGTGTAAATAGGTGTCTTTTTTCCAAATGCTGCTCCAAGTTACTTAATAGGATTTCTTTGT
ATTACATTTTTTTTCAAGAAATAGTACTTAATAAGACTATAAATATGCCATTTCTCTTTCAGCTGTAATG
TTCTCAAAATATTCTTGAATGTACTGTGATGTCAATAAAACTATTTAGTTCATTTTTGTTAAACTCTTGC
ACCTTAATTTTATGATTTTAATCTAAGGAACGTACTTTTATAAAAAGGCAGCTGAAGTTTTGTATAACAG
GTTTTTAAAGTTACTCCCATCTTCTCCAAGAATAGTTTGTCAAAGTTTGTAAATTGTGCCCATGGACTTT
TGTCAAATTCCAATTTTAAGGGTTCGGGAAAGGGCCAGAAAATGACCTTACTTTTCTTTGAAGCCATCTG
ATCAGCTTTCTAACCTTTTTTGGGGGGGAGGGGAGGCATTCAAGTAATAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 77782. Forward Primer - name:077782_F_cDNA_5730406M06Rik, sequence:AAGGAAGCGAGAAAGTGAGAGA; Reverse Primer - name:077782_N_SP6_cDNA_5730406M06Rik, sequence:ATATTACTTGAATGCCTCCCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12533 same embryo
 EMAGE:12531 same embryo
 EMAGE:12535 same embryo
 EMAGE:12534 same embryo
 EMAGE:12532 same embryo
 EurExpress:euxassay_011305 same experiment
 MGI:4828013 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS