Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12707

Sms spermine synthase ( MGI:109490)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707
"Pseudo-wholemount" of euxassay_011541. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011541_01 euxassay_011541_02 euxassay_011541_03 euxassay_011541_04
EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707
euxassay_011541_05 euxassay_011541_06 euxassay_011541_07 euxassay_011541_08 euxassay_011541_09
EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707
euxassay_011541_10 euxassay_011541_11 euxassay_011541_12 euxassay_011541_13 euxassay_011541_14
EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707
euxassay_011541_15 euxassay_011541_16 euxassay_011541_17 euxassay_011541_18 euxassay_011541_19
EMAGE:12707 EMAGE:12707 EMAGE:12707 EMAGE:12707
euxassay_011541_20 euxassay_011541_21 euxassay_011541_22 euxassay_011541_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12707Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12707_wholemount_strong.wlz
12707_wholemount_moderate.wlz
12707_wholemount_weak.wlz
12707_wholemount_possible.wlz
12707_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12707_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
foot
moderate moderate
regionalmoderate expression: see section 07 08 09 23
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 16 17
pons mantle layer
weak weak
regionalweak expression: see section 06 07 08 18 19 20
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 21 22 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 08 19
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 08 19 20
ventral grey horn
weak weak
regionalweak expression: see section 11 12 13 14 16 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 11
cervical ganglion
weak weak
regionalweak expression: see section 09 10 18
thoracic ganglion
weak weak
regionalweak expression: see section 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 10 11 13 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 23
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 16 17 weak expression: see section 12
lower jaw molar
moderate moderate
regionalmoderate expression: see section 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 16 17 weak expression: see section 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 19
metanephros
weak weak
regionalweak expression: see section 07 08 09 10 11 12 17 18 19 20 21 22
left lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13
right lung
weak weak
regionalweak expression: see section 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30373
Entity Detected:Sms, spermine synthase ( MGI:109490)
Sequence:sense strand is shown

>T30373
AATGACGTGTGCTGCGAGCCACCTTCCTGACCTCCATATGCCGTATATGCCATCAAATGTGTCAGGCAAC
TGCTCATGAATTCCTTCTAGTGGTTTTCACTTTTAATTATTATTTTTAATTTAAAAAAGCCAATGGGAAA
AATGTATATTTTGATGAGTTAGGATGTTAATTTTAAAAAGTCAGCCGAAGGACAATTAGACAGCCCAGCA
AAGACTGCAGAATGCACTGACCCCCTAGAATGTGATTTTAGTATTTTTTTTTCTCTGTGTGGGGTTTGGG
TTTTCATTTTGGTTTCAGTAGACCTTTAATTTGGACATGTGGAGGAATGAACATCATTGTTTTGTTCTGG
AGAGAAGTTCCTGATAGTGTTTCTCCCCTCTCACCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6315420), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58182. Forward Primer - name:058182_F_IRAV101_g12_Sms, sequence:AATGACGTGTGCTGCGAG; Reverse Primer - name:058182_R_SP6_IRAV101_g12_Sms, sequence:GGGGTGAGAGGGGAGAAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12705 same embryo
 EMAGE:12704 same embryo
 EMAGE:12708 same embryo
 EMAGE:12703 same embryo
 EMAGE:12706 same embryo
 EurExpress:euxassay_011541 same experiment
 MGI:4828335 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS