Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12724

Peli1 pellino 1 ( MGI:1914495)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724
"Pseudo-wholemount" of euxassay_011663. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011663_01 euxassay_011663_02 euxassay_011663_03 euxassay_011663_04
EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724
euxassay_011663_05 euxassay_011663_06 euxassay_011663_07 euxassay_011663_08 euxassay_011663_09
EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724
euxassay_011663_10 euxassay_011663_11 euxassay_011663_12 euxassay_011663_13 euxassay_011663_14
EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724
euxassay_011663_15 euxassay_011663_16 euxassay_011663_17 euxassay_011663_18 euxassay_011663_19
EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724 EMAGE:12724
euxassay_011663_20 euxassay_011663_21 euxassay_011663_22 euxassay_011663_23 euxassay_011663_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12724Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12724_wholemount_strong.wlz
12724_wholemount_moderate.wlz
12724_wholemount_weak.wlz
12724_wholemount_possible.wlz
12724_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12724_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 16 17 18
forebrain
moderate moderate
homogeneousmoderate expression: see section 09 10 11 13 14 17 18 19 20 21 22 23 24 weak expression: see section 01 02 03 04 05 06 07 08 12 15 16
vibrissa
weak weak
regionalweak expression: see section 03 04 05 06 07 20 21 22 23
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 19 20 21 22 23 24 moderate expression: see section 17 18
hindbrain
moderate moderate
homogeneousmoderate expression: see section 09 10 11 13 14 17 18 19 20 21 22 weak expression: see section 02 03 04 05 06 07 08 12 15 16
midbrain
moderate moderate
homogeneousmoderate expression: see section 09 10 11 13 14 17 18 19 weak expression: see section 04 05 06 07 08 12 15 16
spinal cord
moderate moderate
homogeneousmoderate expression: see section 09 10 11 13 14 weak expression: see section 12 15 16
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 17 weak expression: see section 08 10 11 12 14 15 16 18 19
vomeronasal organ
weak weak
regionalweak expression: see section 11 14 15
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 12 14 15
lower jaw molar
weak weak
regionalweak expression: see section 06 19
upper jaw incisor
weak weak
regionalweak expression: see section 11 15 16
upper jaw molar
weak weak
regionalweak expression: see section 06 19
renal cortex
weak weak
regionalweak expression: see section 06 07 08 09 16 17 18 19 20
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32009
Entity Detected:Peli1, pellino 1 ( MGI:1914495)
Sequence:sense strand is shown

>T32009
CGGATTTATGCTGCAGGGTTTGATTCATCAAAAAACATCTTTCTTGGGGAGAAGGCTGCCAAGTGGAAGA
CATCTGATGGGCAGATGGATGGCTTGACCACTAATGGAGTTCTTGTGATGCATCCACGTAATGGGTTCAC
AGAAGACTCCAAACCTGGAATATGGAGAGAAATATCAGTATGTGGGAACGTCTTCAGTCTGCGTGAAACC
AGATCAGCTCAGCAGAGAGGAAAGATGGTGGAAATTGAAACCAATCAGCTACAAGATGGCTCCTTAATTG
ACCTTTGTGGTGCAACCTTGCTGTGGCGTACTGCAGAAGGCCTTTCCCATACTCCTACTGTGAAGCACTT
AGAAGCTTTAAGACAGGAGATCAATGCAGCTCGGCCGCAGTGCCCTGTAGGGTTCAACACACTAGCCTTC
CCCAGTATGAAGAGGAAGGATGTTGTAGATGAAAAGCAACCATGGGTATATCTAAACTGCGGCCATGTCC
ATGGTTATCATAACTGGGGAAACAAAGAAGAACGTGACGGCAAAGATCGTGAATGTCCTATGTGTAGGTC
TGTTGGTCCCTATGTCCCTCTGTGGCTTGGATGTGAAGCTGGATTTTATGTGGACGCCGGCCCTCCCACC
CATGCCTTTAGCCCCTGTGGGCACGTGTGTTCAGAAAAGACAACGGCTTACTGGTCCCAGATCCCACTTC
CTCATGGTACGCACACTTTTCATGCAGCCTGCCCCTTCTGTGCACATCAGTTGGCTGGTGAACAAGGCTA
TATCAGACTTATTTTCCAAGGACCTTTAGACTAGCAGCTGTCCTCCAGGACTGCATTGTAAGTTTATAAG
CTAAGTGATTGGGTTTGCTAACCGACCCCTTGTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3600130), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 23925. Forward Primer - name:023925_F_IRAV32-35_K07_Peli1, sequence:CGGATTTATGCTGCAGGG; Reverse Primer - name:023925_R_SP6_IRAV32-35_K07_Peli1, sequence:TGGACAAGGGGTCGGTTA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12723 same embryo
 EMAGE:12726 same embryo
 EMAGE:12722 same embryo
 EMAGE:12725 same embryo
 EurExpress:euxassay_011663 same experiment
 MGI:4827152 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS