Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12773

Rora RAR-related orphan receptor alpha ( MGI:104661)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773
"Pseudo-wholemount" of euxassay_011505. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011505_01 euxassay_011505_02 euxassay_011505_03 euxassay_011505_04
EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773
euxassay_011505_05 euxassay_011505_06 euxassay_011505_07 euxassay_011505_08 euxassay_011505_09
EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773
euxassay_011505_10 euxassay_011505_11 euxassay_011505_12 euxassay_011505_13 euxassay_011505_14
EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773
euxassay_011505_15 euxassay_011505_16 euxassay_011505_17 euxassay_011505_18 euxassay_011505_19
EMAGE:12773 EMAGE:12773 EMAGE:12773 EMAGE:12773
euxassay_011505_20 euxassay_011505_21 euxassay_011505_22 euxassay_011505_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12773Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12773_wholemount_strong.wlz
12773_wholemount_moderate.wlz
12773_wholemount_weak.wlz
12773_wholemount_possible.wlz
12773_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12773_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
weak weak
regionalweak expression: see section 09 10 11 19 20 21
thymus primordium
moderate moderate
single cellmoderate expression: see section 13 14 15 weak expression: see section 12 16
vibrissa
strong strong
regionalstrong expression: see section 04 moderate expression: see section 03 05 06 07 11 12 15 18 19 20 21 22 23
thalamus mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 12 13 14 15 16 moderate expression: see section 05 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 15 16 17 18
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 17 18 19
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 13 14 15 16 17 18 19
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
anterior naris
moderate moderate
regionalmoderate expression: see section 10 11 14 15 16
external naris
moderate moderate
regionalmoderate expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30320
Entity Detected:Rora, RAR-related orphan receptor alpha ( MGI:104661)
Sequence:sense strand is shown

>T30320
ACCAGTCGGGATTGGACATCAATGGGATCAAACCCGAACCCATATGTGACTACACACCAGCATCTGGCTT
CTTCCCCTACTGTTCCTTCACCAACGGAGAGACTTCCCCAACCGTGTCCATGGCAGAACTAGAACACCTT
GCCCAGAACATATCCAAATCCCACCTGGAAACCTGCCAGTACTTGCGGGAAGAGCTCCAGCAGATAACGT
GGCAGACCTTCCTGCAGGAGGAGATTGAAAACTACCAGAACAAGCAGAGAGAGGTGATGTGGCAGCTGTG
TGCCATCAAGATTACAGAAGCTATCCAGTATGTGGTGGAGTTTGCCAAACGCATTGATGGATTTATGGAG
CTGTGTCAAAATGATCAAATTGTGCTTCTAAAAGCAGGCTCGCTAGAGGTGGTGTTTATTAGGATGTGCC
GTGCCTTTGACTCTCAGAACAACACCGTGTACTTTGACGGGAAGTATGCGAGCCCCGATGTCTTCAAGTC
CCTAGGTTGTGAAGACTTCATCAGCTTTGTGTTTGAATTTGGGAAGAGTTTGTGTTCTATGCACCTGACC
GAAGACGAAATCGCGTTATTTTCTGCATTCGTACTGATGTCAGCGGATCGCTCGTGGCTTCAGGAAAAGG
TAAAAATAGAAAAGCTGCAACAGAAAATTCAGCTGGCCCTTCAGCACGTCCTACAGAAGAACCACCGAGA
AGATGGAATTCTAACCAAGCTAATATGCAAGGTGTCTACGTTAAGAGCCCTATGTGGACGACATACGGAA
AAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTCCATTTTCCTCCATTATACAAGGAAT
TGTTCACTTCAGAATTTGAGCCAGCCATGCAAATCGATGGGTAAATGTCGCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3592667), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 36735. Forward Primer - name:036735_F_IRAV08-11_E10_Rora, sequence:ACCAGTCGGGATTGGACA; Reverse Primer - name:036735_R_SP6_IRAV08-11_E10_Rora, sequence:GCGCGACATTTACCCATC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12774 same embryo
 EMAGE:12776 same embryo
 EMAGE:12775 same embryo
 EMAGE:12771 same embryo
 EMAGE:12772 same embryo
 EurExpress:euxassay_011505 same experiment
 MGI:4827789 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS