Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12942

Gmnn geminin ( MGI:1927344)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942
"Pseudo-wholemount" of euxassay_013652. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013652_01 euxassay_013652_02 euxassay_013652_03 euxassay_013652_04
EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942
euxassay_013652_05 euxassay_013652_06 euxassay_013652_07 euxassay_013652_08 euxassay_013652_09
EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942
euxassay_013652_10 euxassay_013652_11 euxassay_013652_12 euxassay_013652_13 euxassay_013652_14
EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942
euxassay_013652_15 euxassay_013652_16 euxassay_013652_17 euxassay_013652_18 euxassay_013652_19
EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942 EMAGE:12942
euxassay_013652_20 euxassay_013652_21 euxassay_013652_22 euxassay_013652_23 euxassay_013652_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12942Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12942_wholemount_strong.wlz
12942_wholemount_moderate.wlz
12942_wholemount_weak.wlz
12942_wholemount_possible.wlz
12942_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12942_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 10 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 15 16 17 18 weak expression: see section 08 09
pancreas
weak weak
regionalweak expression: see section 09 10 11 16
thyroid gland
weak weak
regionalweak expression: see section 10 14 15
vibrissa
weak weak
regionalweak expression: see section 04 05 06 20 21
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 09 10 14 15 weak expression: see section 16
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 weak expression: see section 01 02 16 17 18 19 20 21
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 14 15
lower jaw molar
weak weak
regionalweak expression: see section 05 06 17 18 19
upper jaw incisor
weak weak
regionalweak expression: see section 10 11 15
upper jaw molar
weak weak
regionalweak expression: see section 05 06 17 18 19
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
renal cortex
weak weak
regionalweak expression: see section 07 08 09 10 11 17 18 19
testis
weak weak
regionalweak expression: see section 06 07 08 19 20 21
lung
moderate moderate
spottedmoderate expression: see section 04 05 06 07 weak expression: see section 08 09 10 11 12 14 15 16 17 18 19 20 21 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31997
Entity Detected:Gmnn, geminin ( MGI:1927344)
Sequence:sense strand is shown

>T31997
TGTCTGTGAGTCCGAGGGCGCGGGAGACCGAGGGCGGGGCGAGTGCAACTCCGGCCGCGGGATCGCCGGG
CTGGCCCGAATGCCCGGCCTGCTTCTCAGCCACGGGGAGCCGGCCTGGGAGGCGACGATTTGAAGGGACC
CGAGTCTGGGGACTTGAAAGGGACCCGAGTCTCGGTCCGACTGCAAGGCAAAGCTGGGCGAGCTGAGACG
AGGGGCTGCGCCATTGGTGAGTTGAAAAATGAATCTCAGTATGAAGCAGAAGCAGGAGGGAGCCCAAGAG
AATGTGAAGAATAGTCCTGTCCCAAGGAGAACGCTGAAGATGATCCAGCCTTCTGCAGATGGATCTCTTG
TTGGCAGAGAAAATGAGTTGCCAAAAGGCTTGTTCAAAAGGAAGCTTTGGGATGACCAGCTAGCATCTCA
GACTTCAAGCTGTGGTCCAGAAGCTAATGAAAATAAGGATGTTGGAGACCTCACCCAGGAAGCCTTTGAT
CTTATAAGTAAAGAGAACCCATCTTCTCAGTATTGGAAAGAAGTGGCAGAGCAGCGGAGGAAAGCTCTCT
ACGAAGCACTGAAAGAGAATGAGAAACTTCATAAAGAAATTGAACAAAAGGACAGTGAGATTGCCCGCCT
GAGAAAGGAGAATAAAGACTTGGCAGAAGTAGCTGAGCACGTGCAGTACATGGCGGAGGTAATCGAGAGG
CTGAGTAATGAACCTCTGGATAACTTTGAATCACCGGATAGTCAGGAATTTGATTCTGAAGAAGAAGCTG
TTGAGTATTCAGAACTGGAAGACTCAGGAGCTGGGACGTGTGCTGAAGAGACTGTGTCTTCCTCCACGGA
TGCTAGGCCGTGTACATGAGGTGTGGGACGCACTGCCAGCGTTGCCCTTTAGTATAGCTCTTGGTAAACT
AACTACATGGTGCAAGTGCTGGAAGCCAGGTTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3988065), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 35624. Forward Primer - name:035624_F_IRAV32-35_C08_Gmnn, sequence:TGTCTGTGAGTCCGAGGG; Reverse Primer - name:035624_R_SP6_IRAV32-35_C08_Gmnn, sequence:TCAAACCTGGCTTCCAGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12940 same embryo
 EMAGE:12939 same embryo
 EMAGE:12938 same embryo
 EMAGE:12941 same embryo
 EurExpress:euxassay_013652 same experiment
 MGI:4825124 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS