Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12993

Lmod2 leiomodin 2 (cardiac) ( MGI:2135672)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993
"Pseudo-wholemount" of euxassay_013698. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013698_01 euxassay_013698_02 euxassay_013698_03 euxassay_013698_04
EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993
euxassay_013698_05 euxassay_013698_06 euxassay_013698_07 euxassay_013698_08 euxassay_013698_09
EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993
euxassay_013698_10 euxassay_013698_11 euxassay_013698_12 euxassay_013698_13 euxassay_013698_14
EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993
euxassay_013698_15 euxassay_013698_16 euxassay_013698_17 euxassay_013698_18 euxassay_013698_19
EMAGE:12993 EMAGE:12993 EMAGE:12993 EMAGE:12993
euxassay_013698_20 euxassay_013698_21 euxassay_013698_22 euxassay_013698_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12993Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12993_wholemount_strong.wlz
12993_wholemount_moderate.wlz
12993_wholemount_weak.wlz
12993_wholemount_possible.wlz
12993_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12993_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 09 14 15 17 weak expression: see section 10
ventral grey horn
weak weak
regionalweak expression: see section 10 11 13
heart ventricle
weak weak
regionalweak expression: see section 10 11 12 13 14 15
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 13 14 weak expression: see section 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37782
Entity Detected:Lmod2, leiomodin 2 (cardiac) ( MGI:2135672)
Sequence:sense strand is shown

>T37782
TTTGGCTACAGAAGGGGACTTAGTAAATATGAATCCATTGATGAGGATGAACTTCTGGCCTCCCTCTCAC
CTGAAGAGCTGAAGGAGCTTGAGAGGGAGCTGGAAGACATTGAACCTGACCGAAACCTTCCTGTGGGGCT
AAGGCAAAAGAGTCTGACAGAGAAAACCCCAACAGGAAACTTCAGCCGAGAGGCGCTGATGGCGTATTGG
GAAAAGGAGTCCCAAAAACTTTTGGAGAAGGAACGGCTGGGGGAATGTGGAAAGGTTGCAGAAGAAGACA
AGGAAGAGAGTGAAGAGGAACTAATTTTCACAGAGAGCAACAGCGAAGTCTCTGAGGAGGTGTGTACAGA
AGATGAGGAAGAGTCTCAGGAGGAAGAAGAGGATAGCGAGGAAGAAGAGGACAGTGAGGAAGAGGAAGAG
ACAACAGAAGCCACAAAACATATTAATGGAACTGTAAGCTACAATAGTGTTAATACTGATAACTCTAAGC
CAAAGACATTTAAAAGCCAAATAGAAAATATAAATTTAACCAACGGCAACAGTGGAAGAACACAGAGGAA
CTCCGAGTCACCAGCCGCCATTCACCCTTGTGGAAATCCCACTGTTATTGAGGATGCTCTGGAAAAGATT
AGAAACAATGACCCTGATACGACAGAAGTTAATCTGAACAATATAGAGAACATCACCACCCAGACCTTAT
CCCGATTTGCTGAAGCTCTCAAGGAGAACACAGTGGTGAAGACGTTCAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79268. Forward Primer - name:079268_F_cDNA_Lmod2, sequence:TTTGGCTACAGAAGGGGACTTA; Reverse Primer - name:079268_N_SP6_cDNA_Lmod2, sequence:GCTGAACGTCTTCACCACTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12995 same embryo
 EMAGE:12991 same embryo
 EMAGE:12994 same embryo
 EMAGE:12990 same embryo
 EMAGE:12992 same embryo
 EurExpress:euxassay_013698 same experiment
 MGI:4825952 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS