EMAGE mouse gene expression spatial database

EMAGE:13720

Cebpb CCAAT/enhancer binding protein (C/EBP), beta ( MGI:88373)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019532. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019532_01	euxassay_019532_02	euxassay_019532_03	euxassay_019532_04

euxassay_019532_05	euxassay_019532_06	euxassay_019532_07	euxassay_019532_08	euxassay_019532_09

euxassay_019532_10	euxassay_019532_11	euxassay_019532_12	euxassay_019532_13	euxassay_019532_14

euxassay_019532_15	euxassay_019532_16	euxassay_019532_17	euxassay_019532_18	euxassay_019532_19

euxassay_019532_20	euxassay_019532_21	euxassay_019532_22	euxassay_019532_23	euxassay_019532_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

adrenal medulla

moderate

regional

moderate expression: see section 21 weak expression: see section 11 12 13 19 22

submandibular gland primordium

moderate

regional

moderate expression: see section 10 11 13 14 21 22 23 weak expression: see section 12 24

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T55021
Entity Detected:	Cebpb, CCAAT/enhancer binding protein (C/EBP), beta ( MGI:88373)
Sequence:	sense strand is shown >T55021 ACCCTGGGCACCGTGCGCCCTGCCCCGCGCGCTCCGGCCCCGCGCGCGCGCCCGGACCACCGTGCGTGCC CTGCGCGCACCTGCACCTGCACCGAGGGGACACCGCGGGCACACCGCGGGCACCGCGCGCACGCACCTGC ACAGCGCACCGGGTTTCGGGACTTGATGCAATCCGGATCAAACGTGGCTGAGCGCGTGTGGACACGGGAC TGACGCAACACACGTGTAACTGTCAGCCGGGCCCTGAGTAATCACTTAAAGATGTTCCTGCGGG
Notes:	The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ACCCTGGGCACCGTGCGC; Reverse Primer - name:unspecified, sequence:CCCGCAGGAACATCTTTAAGT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:13718 same embryo
	EMAGE:13719 same embryo
	EMAGE:13716 same embryo
	EMAGE:13717 same embryo
	EurExpress:euxassay_019532 same experiment
	MGI:4823797 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source