Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13798

Trip13 thyroid hormone receptor interactor 13 ( MGI:1916966)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798
"Pseudo-wholemount" of euxassay_019567. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019567_01 euxassay_019567_02 euxassay_019567_03 euxassay_019567_04
EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798
euxassay_019567_05 euxassay_019567_06 euxassay_019567_07 euxassay_019567_08 euxassay_019567_09
EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798
euxassay_019567_10 euxassay_019567_11 euxassay_019567_12 euxassay_019567_13 euxassay_019567_14
EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798
euxassay_019567_15 euxassay_019567_16 euxassay_019567_17 euxassay_019567_18 euxassay_019567_19
EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798 EMAGE:13798
euxassay_019567_20 euxassay_019567_21 euxassay_019567_22 euxassay_019567_23 euxassay_019567_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13798Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13798_wholemount_strong.wlz
13798_wholemount_moderate.wlz
13798_wholemount_weak.wlz
13798_wholemount_possible.wlz
13798_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13798_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 15 17 18 weak expression: see section 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 19 20 21 22 weak expression: see section 08
thyroid gland
weak weak
regionalweak expression: see section 13 14 18
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 09 21 22 23
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 14 15 16
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 13 14 15 16
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 17 18
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 weak expression: see section 02 03 04 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 17 18 19 weak expression: see section 16
midgut
moderate moderate
regionalmoderate expression: see section 10 17 18 19 weak expression: see section 08 09 11 12 13 14 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 14 17 weak expression: see section 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 20 21
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17 weak expression: see section 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 20 21
liver
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 weak expression: see section 11 12 13 14 15 17 18 19 20 21 22 23 24
metanephros
moderate moderate
regionalmoderate expression: see section 09 10 13 19 20 21 22 23 weak expression: see section 11 12
testis
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 07 08 09 23
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
axial skeleton
weak weak
regionalweak expression: see section 07 08 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55206
Entity Detected:Trip13, thyroid hormone receptor interactor 13 ( MGI:1916966)
Sequence:sense strand is shown

>T55206
GTGGCTTTCGTGGATAGAGCTGACATCAAGCAATACATTGGCCCCCCCTCTGCAGCAGCCATCTTCAAAA
TCTACCTGTCTTGTTTAGAAGAACTGATGAAGTGCCAGATCATATATCCTCGTCAGCAGCTGTTGACCCT
TCGGGAGCTGGAAATGATTGGCTTCATTGAAAATAATGTGTCAAAGTTGAGCCTCCTTTTGAGTGAAATT
TCAAGGAAGAGTGAGGGCCTCAGTGGCCGGGTCTTGAGGAAACTTCCTTTCCTGGCTCATGCTCTCTACA
TCCAGGCCCCCAGCGTCACCATCGAGGGTTTCCTCCAGGCCCTATCTCTGGCAGTGGACAAACAGTTTGA
GGAGAAAAAGAAACTTTCAGCTTATGTTTGATCCCAGACATCCATATCTATGGCTTTCAATGGACAAGTA
GGAGGTGATACCGTCTACCTCACAGTGTGCATCAGAAATGACTCTAAGCCATGTAGATCTGCAGGCCAGA
CAGATGGGTGTACAATCTTTGTCAAAAGGACTATGTGTTATTTTACAGTGCATATCTAAAGGCAAAAAAG
ACTGCTTGTCTTTTTCACTGTTTTTAAAAGATAATTCCAGTCTGTTTGCATCTATGTAAAGCCCCATCCT
GACTCAAGCCTGTCAGACACAAGATGTTAGAATTTGTTTAAAATAAAGGGAGATCAAAACAGCTGTCATA
GAACAAGGGGGATGCTAACTAATGCAGTTACAGCATTGAAAGATGGATTCTTTGCTCAGGCTAGAAGGGA
GCAGTTGCTTTCTGGCTTGAGTCGGCTTTGGTTAGCACAGGATGCTATGTGATGGGTGAGAAAGACGTGT
TGCTGTGATACGGAAACTGAGAGGGGACTGCAGGTAAGAAGATGAAGAGTTCTTTGGTAGTGCACAGGAG
CAGTGTGTGCTTTCTATGGTCACGTCAATCAGGCAATG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GTGGCTTTCGTGGATAGAGC; Reverse Primer - name:unspecified, sequence:CATTGCCTGATTGACGTGAC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13801 same embryo
 EMAGE:13799 same embryo
 EMAGE:13800 same embryo
 EurExpress:euxassay_019567 same experiment
 MGI:4828924 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS