Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13868

Mir423 microRNA 423 ( MGI:3629888)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868
euxassay_019279_01 euxassay_019279_02 euxassay_019279_03 euxassay_019279_04 euxassay_019279_05
EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868
euxassay_019279_06 euxassay_019279_07 euxassay_019279_08 euxassay_019279_09 euxassay_019279_10
EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868
euxassay_019279_11 euxassay_019279_12 euxassay_019279_13 euxassay_019279_14 euxassay_019279_15
EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868
euxassay_019279_16 euxassay_019279_17 euxassay_019279_18 euxassay_019279_19 euxassay_019279_20
EMAGE:13868 EMAGE:13868 EMAGE:13868 EMAGE:13868
euxassay_019279_21 euxassay_019279_22 euxassay_019279_23 euxassay_019279_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13868Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13868_wholemount_strong.wlz
13868_wholemount_moderate.wlz
13868_wholemount_weak.wlz
13868_wholemount_possible.wlz
13868_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13868_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70017
Entity Detected:Mir423, microRNA 423 ( MGI:3629888)
Sequence:sense strand is shown

>T70017
TGAGGGGCAGAGAGCGAGACTTT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-423-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13869 same embryo
 EurExpress:euxassay_019279 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS