Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13882

Cdh16 cadherin 16 ( MGI:106671)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13882 EMAGE:13882 EMAGE:13882 EMAGE:13882 EMAGE:13882
"Pseudo-wholemount" of euxassay_007740. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007740_01 euxassay_007740_02 euxassay_007740_03 euxassay_007740_04
EMAGE:13882 EMAGE:13882 EMAGE:13882 EMAGE:13882 EMAGE:13882
euxassay_007740_05 euxassay_007740_06 euxassay_007740_07 euxassay_007740_08 euxassay_007740_09
EMAGE:13882 EMAGE:13882 EMAGE:13882 EMAGE:13882 EMAGE:13882
euxassay_007740_10 euxassay_007740_11 euxassay_007740_12 euxassay_007740_13 euxassay_007740_14
EMAGE:13882 EMAGE:13882 EMAGE:13882 EMAGE:13882 EMAGE:13882
euxassay_007740_15 euxassay_007740_16 euxassay_007740_17 euxassay_007740_18 euxassay_007740_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13882Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13882_wholemount_strong.wlz
13882_wholemount_moderate.wlz
13882_wholemount_weak.wlz
13882_wholemount_possible.wlz
13882_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13882_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thyroid gland
strong strong
regionalstrong expression: see section 09 10 11 13
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 weak expression: see section 08
urinary system
strong strong
regionalstrong expression: see section 03 04 05 16 17
kidney calyx
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 13 14 15
ureter
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15
male reproductive system
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
right lung
strong strong
regionalstrong expression: see section 12 13 14 15 moderate expression: see section 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1371
Entity Detected:Cdh16, cadherin 16 ( MGI:106671)
Sequence:sense strand is shown

>T1371
CCTCGAGNCTGTTGGCCTACTGGAAATTTGCCAGAGCTCCCTGAAGAAGGATTCCTTTCTCCTGGAAACT
GGACCAAGGGAGAGGCTTTGGGCATCTGAAGGTCTGCCTTGACCATGATCTCTGCCCGGCCGTGGCTACT
TTACCTCTCTGTTATTCAGGCTTTCACCACTGAGGCCCAGCCTGCAGAAAGCCTGCACACAGAAGTCCCT
GAAAACTATGGTGGAAATTTCCCTTTTTACATACTCAAGCTACCACTACCCCTGGGGAGAGATGAAGGCC
ACATTGTCCTATCAGGAGACTCAAACACGGCAGATCAAAACACCTTTGCTGTGGACACAGACTCTGGCTT
TCTAGTGGCGACAAGGACCCTGGACCGGGAAGAGAAAGCAGAATACCAACTACAGGTCACCTTGGAGTCT
GAGGATGGACGTATCTTGTGGGGTCCACAGCTTGTGACTGTGCATGTGAAAGATGAGAATGACCAGGTAC
CCCAATTCTCCCAGGCCATCTACAGAGCTCAGCTGAGCCAGGGCACCAGGCCTGGGGTCCCCTTCCTCTT
CCTTGAGG
Notes:The probe template was PCR amplified from IMAGE:2331777 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2331777 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13884 same embryo
 EMAGE:13883 same embryo
 EMAGE:13885 same embryo
 EMAGE:13886 same embryo
 EMAGE:13881 same embryo
 EurExpress:euxassay_007740 same experiment
 MGI:4823765 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS