Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13932

Prnp prion protein ( MGI:97769)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13932 EMAGE:13932 EMAGE:13932 EMAGE:13932 EMAGE:13932
"Pseudo-wholemount" of euxassay_007857. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007857_01 euxassay_007857_02 euxassay_007857_03 euxassay_007857_04
EMAGE:13932 EMAGE:13932 EMAGE:13932 EMAGE:13932 EMAGE:13932
euxassay_007857_05 euxassay_007857_06 euxassay_007857_07 euxassay_007857_08 euxassay_007857_09
EMAGE:13932 EMAGE:13932 EMAGE:13932 EMAGE:13932 EMAGE:13932
euxassay_007857_10 euxassay_007857_11 euxassay_007857_12 euxassay_007857_13 euxassay_007857_14
EMAGE:13932 EMAGE:13932 EMAGE:13932 EMAGE:13932 EMAGE:13932
euxassay_007857_15 euxassay_007857_16 euxassay_007857_17 euxassay_007857_18 euxassay_007857_19
EMAGE:13932 EMAGE:13932
euxassay_007857_20 euxassay_007857_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13932Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13932_wholemount_strong.wlz
13932_wholemount_moderate.wlz
13932_wholemount_weak.wlz
13932_wholemount_possible.wlz
13932_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13932_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 05 18 19
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 15 moderate expression: see section 08 09 12 14
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 06 15
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 14 15 16 17 18
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 07
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 14 15
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 14
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 13
cervical ganglion
moderate moderate
regionalmoderate expression: see section 13
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 13 14 15
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 19 weak expression: see section 20 21
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 12 13 14 15 weak expression: see section 07
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 12
tongue
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 13 14
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 13 14
metanephros
strong strong
regionalstrong expression: see section 07 08 09 10 15 16 17 18
trachea
moderate moderate
regionalmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1342
Entity Detected:Prnp, prion protein ( MGI:97769)
Sequence:sense strand is shown

>T1342
TCCTCNAGACTGTTGGCCTACTGGGATTCTGGGCGCTGCGTCGCATCGGTGGCAGGACTCCTGAGTATAT
TTCAGAACTGAACCATTTCAACCGAGCTGAAGCATTCTGCCTTCCTAGTGGTACCAGTCCAATTTAGGAG
AGCCAAGCAGACTATCAGTCATCATGGCGAACCTTGGCTACTGGCTGCTGGCCCTCTTTGTGACTATGTG
GACTGATGTCGGCCTCTGCAAAAAGCGGCCAAAGCCTGGAGGGTGGAACACCGGTGGAAGCCGGTATCCC
GGGCAGGGAAGCCCTGGAGGCAACCGTTACCCACCTCAGGGTGGCACCTGGGGGCAGCCCCACGGTGGTG
GCTGGGGACAACCCCATGGGGGCAGCTGGGGACAACCTCATGGTGGTAGTTGGGGTCAGCCCCATGGCGG
TGGATGGGGCCAAGGAGGGGGTACCCATAATCAGTGGAACAAGCCCAGCAAACCAAAAACCAACCTCAAG
CATGTGGCAGGGGCTGCGGCAGCTGGGGCAGTAGTGGGGGGCCTTGGTGGCTACATGCTGGGGAGCGCCA
TGAGCAGGCCC
Notes:The probe template was PCR amplified from IMAGE:2286235 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2286235 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13933 same embryo
 EMAGE:13930 same embryo
 EMAGE:13931 same embryo
 EurExpress:euxassay_007857 same experiment
 MGI:4827434 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS