Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14038

Creld1 cysteine-rich with EGF-like domains 1 ( MGI:2152539)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038
"Pseudo-wholemount" of euxassay_007821. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007821_01 euxassay_007821_02 euxassay_007821_03 euxassay_007821_04
EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038
euxassay_007821_05 euxassay_007821_06 euxassay_007821_07 euxassay_007821_08 euxassay_007821_09
EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038
euxassay_007821_10 euxassay_007821_11 euxassay_007821_12 euxassay_007821_13 euxassay_007821_14
EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038
euxassay_007821_15 euxassay_007821_16 euxassay_007821_17 euxassay_007821_18 euxassay_007821_19
EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038 EMAGE:14038
euxassay_007821_20 euxassay_007821_21 euxassay_007821_22 euxassay_007821_23 euxassay_007821_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14038Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14038_wholemount_strong.wlz
14038_wholemount_moderate.wlz
14038_wholemount_weak.wlz
14038_wholemount_possible.wlz
14038_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14038_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 09 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 weak expression: see section 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 10 17 18
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 10 14 15 weak expression: see section 09 11 12 13
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09 16
cervical ganglion
weak weak
regionalweak expression: see section 08 17
thoracic ganglion
weak weak
regionalweak expression: see section 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 13 16 17 weak expression: see section 09 10 14 15 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3136
Entity Detected:Creld1, cysteine-rich with EGF-like domains 1 ( MGI:2152539)
Sequence:sense strand is shown

>T3136
TGGCCTCGAGCAGATTCGGACGAGGGCTCCACTGCCCCCAAGGGGCCTGGTCCCATCTCTGCTCTGGTGC
TTGAGCCTGTTTCTGAGCCTCCCAGGACCTGTCTGGCTCCAACCCTCTCCTCCTCCCCATCCTTCTCCCC
GAGCTGAGCCCCATCCGTGTCATACCTGCCGGGCACTGGTGGACAACTTCAACAAGGGCCTGGAGAGAAC
CATCCGGGACAACTTCGGGGGTGGAAACACGGCCTGGGAGGAAGAGAAGTTGTCCAAATACAAAGACAGT
GAGACCCGCCTGGTGGAGGTGCTGGAGGGCGTGTGCAGCAGGTCAGACTTCGAGTGCCACCGCCTGCTCG
AGCTGAGCGAGGAGCTGGTGGAAAACTGGTGGTTTCACAGGCAGCAGGAAGCCCCCGACCTCTTCCAGTG
GCTCTGTTCCGATTCCCTGAAGCTCTGCTGCCCCTCTGGCACCTTTGGGCCCTCCTGCCTGCCATGTCCT
GGGGGCACAGAGAGGCCCTGCGGTGGCTACGGGCAGTGTGAAGGGGAAGGGACTC
Notes:The probe template was PCR amplified from IMAGE:1547690 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547690 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14041 same embryo
 EMAGE:14040 same embryo
 EMAGE:14037 same embryo
 EMAGE:14042 same embryo
 EMAGE:14039 same embryo
 EurExpress:euxassay_007821 same experiment
 MGI:4824051 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS