Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14475

Cox6a2 cytochrome c oxidase, subunit VI a, polypeptide 2 ( MGI:104649)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475
"Pseudo-wholemount" of euxassay_005343. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005343_01 euxassay_005343_02 euxassay_005343_03 euxassay_005343_04
EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475
euxassay_005343_05 euxassay_005343_06 euxassay_005343_07 euxassay_005343_08 euxassay_005343_09
EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475
euxassay_005343_10 euxassay_005343_11 euxassay_005343_12 euxassay_005343_13 euxassay_005343_14
EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475
euxassay_005343_15 euxassay_005343_16 euxassay_005343_17 euxassay_005343_18 euxassay_005343_19
EMAGE:14475 EMAGE:14475 EMAGE:14475 EMAGE:14475
euxassay_005343_20 euxassay_005343_21 euxassay_005343_22 euxassay_005343_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14475Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14475_wholemount_strong.wlz
14475_wholemount_moderate.wlz
14475_wholemount_weak.wlz
14475_wholemount_possible.wlz
14475_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14475_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 09 10 12 13 14 15 16 17 18 19 20 21 23
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
heart
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
tongue
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8304
Entity Detected:Cox6a2, cytochrome c oxidase, subunit VI a, polypeptide 2 ( MGI:104649)
Sequence:sense strand is shown

>T8304
GAGACAGAGAAGGACAGTGCCATTCCTAGCCTCCCTTTGACAATGGCTCTGCCTCTAAAGGTCCTGAGCC
GGAGCATGGCCAGCGCAGCCAAAGGAGACCATGGAGGGGCAGGAGCCAACACCTGGCGCCTCCTGACCTT
TGTGCTGGCTCTTCCCGGCGTAGCCCACTGCTCCCTTAACTGCTGGATGCACGCTGGCCACCACGAGCGC
CCAGAGTTCATCCCGTATCACCACCTCCGCATCCGAACCAAGCCCTTCGCCTGGGGGGACGGCAACCACA
CGCTTTTCCACAATCCCCACGTCAATCCTTTGCCCACCGGTTATGAGCACCCTTGATGTCTCAGCAGACA
CGCTCTGCCAGCAATCTTCAAATTGGCCTTCTGCACACCGGCTCTGAGAGCCCCTGAGGTTCCAGTGGAC
AGTTCCAAGCTCAATAAAGGTGTGGAAGTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1447375 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1447375 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14477 same embryo
 EMAGE:14476 same embryo
 EMAGE:14474 same embryo
 EurExpress:euxassay_005343 same experiment
 MGI:4824020 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS