Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14715

Eps15 epidermal growth factor receptor pathway substrate 15 ( MGI:104583)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14715 EMAGE:14715 EMAGE:14715 EMAGE:14715 EMAGE:14715
"Pseudo-wholemount" of euxassay_005655. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005655_01 euxassay_005655_02 euxassay_005655_03 euxassay_005655_04
EMAGE:14715 EMAGE:14715 EMAGE:14715 EMAGE:14715 EMAGE:14715
euxassay_005655_05 euxassay_005655_06 euxassay_005655_07 euxassay_005655_08 euxassay_005655_09
EMAGE:14715 EMAGE:14715 EMAGE:14715 EMAGE:14715 EMAGE:14715
euxassay_005655_10 euxassay_005655_11 euxassay_005655_12 euxassay_005655_13 euxassay_005655_14
EMAGE:14715 EMAGE:14715 EMAGE:14715 EMAGE:14715 EMAGE:14715
euxassay_005655_15 euxassay_005655_16 euxassay_005655_17 euxassay_005655_18 euxassay_005655_19
EMAGE:14715
euxassay_005655_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14715Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14715_wholemount_strong.wlz
14715_wholemount_moderate.wlz
14715_wholemount_weak.wlz
14715_wholemount_possible.wlz
14715_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14715_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11
metencephalon rest of alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 08 09 10 11 12 13 14 15
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11
facial vii ganglion
strong strong
regionalstrong expression: see section 01
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 11 12
trigeminal v ganglion
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 04 05 06 07 14 15 16 17 18
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 04 11 12
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T952
Entity Detected:Eps15, epidermal growth factor receptor pathway substrate 15 ( MGI:104583)
Sequence:sense strand is shown

>T952
CCTCGAGNCTGTTGGCCTACTGGGTGCATGATGGAAACACCATGGCTGCGGCAGCCCAGCTCTCCCTGAC
ACAGTTGTCAAGTGGGAATCCTGTATATGAAAAATACTACAGACAGGTTGAGGCAGGCAATACTGGAAGG
GTGTTGGCGTTAGATGCTGCTGCATTCCTGAAAAAGTCAGGGCTTCCAGACTTGATTCTTGGAAAGATTT
GGGATTTAGCTGACACAGATGGCAAAGGTGTCCTGAGCAAACAAGAATTCTTTGTTGCTTTACGGCTTGT
GGCATGTGCTCAGAATGGACTGGAAGTTTCACTGAGTAGCCTAAGTCTGGCTGTTCCTCCACCAAGATTT
CATGACTCCAGCAGTCCGTTGCTAACCAGTGGGCCCTCAGTTGCTGAGCTCCCGTGGGCTGTAAAGTCTG
AAGATAAAGCCAAATATGATGCAATTTTTGACAGTTTAAGCCCAGTGGATGGATTTTTGTCTGGTGATAA
AGTGAAACCAGTGTTGCTCAACTCTAAGTTACCTGTGGAAATCCTTGGAAGAGTTTGGGAGTTGAG
Notes:The probe template was PCR amplified from IMAGE:1970244 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1970244 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14711 same embryo
 EMAGE:14712 same embryo
 EMAGE:14713 same embryo
 EMAGE:14714 same embryo
 EurExpress:euxassay_005655 same experiment
 MGI:4824601 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS