Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14732

Usp20 ubiquitin specific peptidase 20 ( MGI:1921520)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14732 EMAGE:14732 EMAGE:14732 EMAGE:14732 EMAGE:14732
"Pseudo-wholemount" of euxassay_005695. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005695_01 euxassay_005695_02 euxassay_005695_03 euxassay_005695_04
EMAGE:14732 EMAGE:14732 EMAGE:14732 EMAGE:14732 EMAGE:14732
euxassay_005695_05 euxassay_005695_06 euxassay_005695_07 euxassay_005695_08 euxassay_005695_09
EMAGE:14732 EMAGE:14732 EMAGE:14732 EMAGE:14732 EMAGE:14732
euxassay_005695_10 euxassay_005695_11 euxassay_005695_12 euxassay_005695_13 euxassay_005695_14
EMAGE:14732 EMAGE:14732 EMAGE:14732 EMAGE:14732 EMAGE:14732
euxassay_005695_15 euxassay_005695_16 euxassay_005695_17 euxassay_005695_18 euxassay_005695_19
EMAGE:14732 EMAGE:14732 EMAGE:14732
euxassay_005695_20 euxassay_005695_21 euxassay_005695_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14732Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14732_wholemount_strong.wlz
14732_wholemount_moderate.wlz
14732_wholemount_weak.wlz
14732_wholemount_possible.wlz
14732_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14732_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 17 18 19 weak expression: see section 05 06 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 06 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 08 16 17 18 19 20 21 weak expression: see section 05 06 07
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 07
trigeminal v nerve
weak weak
regionalweak expression: see section 15
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 14
cervical ganglion
weak weak
regionalweak expression: see section 07 08 14 15
thoracic ganglion
weak weak
regionalweak expression: see section 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2745
Entity Detected:Usp20, ubiquitin specific peptidase 20 ( MGI:1921520)
Sequence:sense strand is shown

>T2745
TGGATGCAGGGCTCTTTGTGTAGGCCAGCAGCCCCTATATCATGATGGAGACCCCTGCTGCCCGTGTTTG
TTCTGTTGACTATTGTAGTGGGACAGAGAAAGGGCAAGCTTTGCTTTAGAGGGTAGAGGACCTGCCACCT
TGTCCTGCTGAGACCACTGGCAGACCAACTGTCATTTGCTCTGTGAAGAGGCTCCTAAGACCCTGGGGGA
GGGAAAACAGATACCTCATGCACTGGCCCACTGTCTGACGCTCCTTCATCCTCTGTGCGGTCTGGAGTGA
GCCTGGTCCCCTAGCCACCCCCTAGCCTTGGTGTCTTGAGCCAATTCTGAGATGTGGTCTGTGTCCTGGA
CCTGCTGAGCCTAGAGAGATTGTCCTATGTATGTCTGAGATCCTGGAGAAACCTAACCGAACTTCCAGGG
CAGGGTGTTCAAAGCTAAGTCTGGAGTGGTGAGGGGGGGATCCTGGGACCAAGAGGGCTCCAGTGGCCAC
CTGTCTCTTCAGAAGTGGGTACCAGCAGCTCATCCCCAAAGGCCTGGGTGTT
Notes:The probe template was PCR amplified from IMAGE:1513924 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1513924 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14735 same embryo
 EMAGE:14733 same embryo
 EMAGE:14734 same embryo
 EurExpress:euxassay_005695 same experiment
 MGI:4829130 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS