Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14733

Pepd peptidase D ( MGI:97542)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733
"Pseudo-wholemount" of euxassay_005690. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005690_01 euxassay_005690_02 euxassay_005690_03 euxassay_005690_04
EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733
euxassay_005690_05 euxassay_005690_06 euxassay_005690_07 euxassay_005690_08 euxassay_005690_09
EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733
euxassay_005690_10 euxassay_005690_11 euxassay_005690_12 euxassay_005690_13 euxassay_005690_14
EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733
euxassay_005690_15 euxassay_005690_16 euxassay_005690_17 euxassay_005690_18 euxassay_005690_19
EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733 EMAGE:14733
euxassay_005690_20 euxassay_005690_21 euxassay_005690_22 euxassay_005690_23 euxassay_005690_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14733Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14733_wholemount_strong.wlz
14733_wholemount_moderate.wlz
14733_wholemount_weak.wlz
14733_wholemount_possible.wlz
14733_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14733_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 14 15 16 17
tongue muscle
moderate moderate
regionalmoderate expression: see section 13 14 15 16
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17 18
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 13 14 17 18 19 20 weak expression: see section 08 11 12 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2729
Entity Detected:Pepd, peptidase D ( MGI:97542)
Sequence:sense strand is shown

>T2729
CTTGATCCCACAGTGTGATGATGCAGTCTCAGGGCCCTGAGCTTCAAAGGCAGCCTGGGCTATCTCACCC
ACCCTGGCTTACCATAGCCTCCTTAAACCACAGGGGTCTGGTGGCCTGATATGCATCGGCTGGCTGACCG
TATCCACCTGGAGGAACTGGCACGCATTGGCCTCCTGAGTGGCAGTGTGGATGCCATGCTCCAGGTCCAC
CTGGGAGCAGTATTCATGCCACATGGACTTGGCCACTTTCTGGGCCTAGATGTGCACGACGTGGGAGGCT
ACCCTGAGGGTGTAGAGCGCATCGATGAACCTGGCCTGCGAAGCCTGCGTACGGCAAGGCACCTGGAGCC
GGGCATGGTGCTGACTGTGGAGCCAGGCATCTACTTCATTGACCACCTCTTGGACCAGGCCCTGGCAGAC
CCGGCCCAAGCCTGCTTCTTTAACCAAGAGGTCCTGCAGCGCTTCCGCAACTTCGGTGGGGTGCGGATCG
AGGAAGATGTTGTCGTGACTGACAGCGGCATGGAGCTGCTGACATG
Notes:The probe template was PCR amplified from IMAGE:1513277 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1513277 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14735 same embryo
 EMAGE:14732 same embryo
 EMAGE:14734 same embryo
 EurExpress:euxassay_005690 same experiment
 MGI:4827155 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS