Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14825

Rfx4 regulatory factor X, 4 (influences HLA class II expression) ( MGI:1918387)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825
"Pseudo-wholemount" of euxassay_005798. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005798_01 euxassay_005798_02 euxassay_005798_03 euxassay_005798_04
EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825
euxassay_005798_05 euxassay_005798_06 euxassay_005798_07 euxassay_005798_08 euxassay_005798_09
EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825
euxassay_005798_10 euxassay_005798_11 euxassay_005798_12 euxassay_005798_13 euxassay_005798_14
EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825
euxassay_005798_15 euxassay_005798_16 euxassay_005798_17 euxassay_005798_18 euxassay_005798_19
EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825 EMAGE:14825
euxassay_005798_20 euxassay_005798_21 euxassay_005798_22 euxassay_005798_23 euxassay_005798_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14825Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14825_wholemount_strong.wlz
14825_wholemount_moderate.wlz
14825_wholemount_weak.wlz
14825_wholemount_possible.wlz
14825_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14825_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 03 04 05 06 07 08 09 10 22 23
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 not examined expression: see section 22
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22
pons ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 08 09 10 11 12 14 15 16 17 18
midbrain ventricular layer
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 08 09 10 11 14 15 16 17
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 moderate expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35528
Entity Detected:Rfx4, regulatory factor X, 4 (influences HLA class II expression) ( MGI:1918387)
Sequence:sense strand is shown

>T35528
GACTTTCCAAACGTCAAAGACCTAAATCTGCCAGCCAGTCTTCCTGAGGAGAAGGTGTCTACCTTTATTA
TGATGTACAGAACACACTGTCAGAGAATACTGGACACTGTAATAAGAGCCAACTTTGATGAGGTTCAAAG
TTTACTTCTGCACTTTTGGCAAGGGATGCCGCCCCACATGCTGCCCGTGCTAGGCTCCTCCACGGTGGTG
AACATCGTGGGTGTGTGTGACTCCATCCTCTACAAAGCCATCTCCGGTGTGTTGATGCCCACGGTGCTGC
AGGCGTTGCCGGACAGCTTAACTCAGGTGATCCGAAAGTTTGCCAAGCAGCTGGACGAGTGGCTGAAAGT
GGCTCTCCACGATCTCCCGGAAAACCTGAGAAACATCAAATTTGAATTATCAAGGAGGTTTTCCCAAATC
CTAAGGAGGCAAACATCGCTGAACCATCTGTGCCAGGCATCTCGAACGGTGATCCACAGTGCAGACATCA
CGTTCCAGATGCTGGAGGACTGGAGGAATGTGGACCTGAGTAGCATCACCAAGCAGACTCTGTATACCAT
GGAGGACTCTCGGGATGAGCACCGCAGACTCATCATCCAGTTGTACCAGGAGTTTGACCACCTGCTGGAG
GAACAGTCCCCCATCGAGTCTTACATAGAATGGCTGGATACCATGGTAGACCGATGCGTTGTAAAGGTGG
CTGCCAAGAGACAAGGGTCTCTGAAGAAAGTAGCCCAACAGTTCCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91411. Forward Primer - name:091411_F_cDNA_Rfx4, sequence:GACTTTCCAAACGTCAAAGACC; Reverse Primer - name:091411_N_SP6_cDNA_Rfx4, sequence:CAGGAACTGTTGGGCTACTTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14821 same embryo
 EMAGE:14820 same embryo
 EMAGE:14823 same embryo
 EMAGE:14822 same embryo
 EMAGE:14824 same embryo
 EurExpress:euxassay_005798 same experiment
 MGI:4827706 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS