Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14975

C130071C03Rik RIKEN cDNA C130071C03 gene ( MGI:2443574)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975
"Pseudo-wholemount" of euxassay_008007. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008007_01 euxassay_008007_02 euxassay_008007_03 euxassay_008007_04
EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975
euxassay_008007_05 euxassay_008007_06 euxassay_008007_07 euxassay_008007_08 euxassay_008007_09
EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975
euxassay_008007_10 euxassay_008007_11 euxassay_008007_12 euxassay_008007_13 euxassay_008007_14
EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975
euxassay_008007_15 euxassay_008007_16 euxassay_008007_17 euxassay_008007_18 euxassay_008007_19
EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975 EMAGE:14975
euxassay_008007_20 euxassay_008007_21 euxassay_008007_22 euxassay_008007_23 euxassay_008007_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14975Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14975_wholemount_strong.wlz
14975_wholemount_moderate.wlz
14975_wholemount_weak.wlz
14975_wholemount_possible.wlz
14975_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14975_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 12 13 14 15
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14 15
telencephalon ventricular layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22
metencephalon rest of alar plate marginal layer
weak weak
regionalweak expression: see section 09 15
metencephalon rest of alar plate ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 10 11 12 13 14 16 17 18 19 20
pons ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
midbrain ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36075
Entity Detected:C130071C03Rik, RIKEN cDNA C130071C03 gene ( MGI:2443574)
Sequence:sense strand is shown

>T36075
CCAGAGAAACCTGTAAAGCCACTGGTAGTTTCATTTAGAAAAGCCAAGAGACTTTAATAACACAACTTCT
CAGTTTGGCCGCTGTACACGTGCCAAAGTTTGACTGCTGTAGAGGCAGTCGAGAAGACCCTTGCTTATTT
ACCTTGGAAGCACTGTTTGTGCAAACAAGCTTTCATTGTTAAGTGCCTGTATTCCTTTCATTTGCTTCAT
GTCCAGGGGTGCTATTTACCTAGAACCATTGTCTACTACAATTAACATTTACATTACAAAGTGTGTGCTT
TTCTTTCTCAAGGAGGTTCAATTAAGGCAATAAGATGTTTGCTGGGGAAACCTATTGTTTACTCAAAGCT
CTCAATGGAGTCACATTACTGAAGTTTTTGCCTACATCTTGGGTCGTTTATGTAAATATGTTAACTATAA
CATCTAAGGAAAATAAACAATATTAAAATTATGTGTTTGCCATTGTCATATCCAACTTGCTTTGTATCAT
ACTAATGTTACATAACTTATCGATCAATAAAAATACATTTCAATGTTATTTTCATTTTACTTTTTGCTGT
CCCACTGCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69462. Forward Primer - name:069462_F_cDNA_C130071C03Rik, sequence:CCAGAGAAACCTGTAAAGCCAC; Reverse Primer - name:069462_N_SP6_cDNA_C130071C03Rik, sequence:GAGCAGTGGGACAGCAAAAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14972 same embryo
 EMAGE:14977 same embryo
 EMAGE:14973 same embryo
 EMAGE:14976 same embryo
 EMAGE:14974 same embryo
 EurExpress:euxassay_008007 same experiment
 MGI:4823531 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS