Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15252

Dtna dystrobrevin alpha ( MGI:106039)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252
"Pseudo-wholemount" of euxassay_010455. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010455_01 euxassay_010455_02 euxassay_010455_03 euxassay_010455_04
EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252
euxassay_010455_05 euxassay_010455_06 euxassay_010455_07 euxassay_010455_08 euxassay_010455_09
EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252
euxassay_010455_10 euxassay_010455_11 euxassay_010455_12 euxassay_010455_13 euxassay_010455_14
EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252
euxassay_010455_15 euxassay_010455_16 euxassay_010455_17 euxassay_010455_18 euxassay_010455_19
EMAGE:15252 EMAGE:15252 EMAGE:15252 EMAGE:15252
euxassay_010455_20 euxassay_010455_21 euxassay_010455_22 euxassay_010455_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15252Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15252_wholemount_strong.wlz
15252_wholemount_moderate.wlz
15252_wholemount_weak.wlz
15252_wholemount_possible.wlz
15252_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15252_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 13 15 weak expression: see section 14 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 16 18 19 20 21 weak expression: see section 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05 06
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 09 10 12 13
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 14 15 weak expression: see section 08 09 10 13
inner ear vestibular component
moderate moderate
regionalmoderate expression: see section 02 03 04 19 weak expression: see section 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16
stomach
weak weak
regionalweak expression: see section 03 04 05 06 07 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30207
Entity Detected:Dtna, dystrobrevin alpha ( MGI:106039)
Sequence:sense strand is shown

>T30207
CATGTTCCCAGACCAGCCTGAAAAGCCACTCAACTTGGCTCACATCGTGCCTCCGAGACCTGTAACCAGC
ATGAACGACACACTCTTTTCCCACTCTGTTCCCTCCTCAGGAAGTCCTTTCATCACCAGGAGTATGCTTG
AGAGTTCAAACCGGCTTGATGAAGAACACAGGCTGATCGCCAGGTACGCCGCACGACTGGCAGCAGAATC
CTCCTCATCACAGCCCACACAGCAGAGGAGTGCCCCTGACATCTCCTTCACCATCGATGCAAATAAACAG
CAAAGGCAGCTGATTGCAGAGCTAGAGAACAAGAACAGAGAAATCTTACAAGAGATTCAGAGACTTCGGG
TAGAACATGAGCAAGCTTCCCAGCCCACGCCAGAGAAAGCTCAGCAGAACCCAACCTTGCTGGCAGAACT
CCGGCTCCTCAGACAGCGAAAGGATGAGCTAGAACAGAGAATGTCTGCTCTCCAGGAGAGCCGGAGAGAG
CTGATGGTCCAGTTGGAAGGTCTCATGAAGCTCCTGAAGACCCAGGGGGCAAGCTCCCCACGCTCTTCCC
CCAGCCACACCATCAGCAGGCCGATCCCCATGCCCATCCGTTCAGCATCTGCCTGTCCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4505583), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9344. Forward Primer - name:009344_F_IRAV51-54_K15_Dtna, sequence:CATGTTCCCAGACCAGCC; Reverse Primer - name:009344_R_SP6_IRAV51-54_K15_Dtna, sequence:GTGGGACAGGCAGATGCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15254 same embryo
 EMAGE:15257 same embryo
 EMAGE:15256 same embryo
 EMAGE:15253 same embryo
 EMAGE:15255 same embryo
 EurExpress:euxassay_010455 same experiment
 MGI:4824407 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS