Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15257

Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) ( MGI:95819)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257
"Pseudo-wholemount" of euxassay_010443. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010443_01 euxassay_010443_02 euxassay_010443_03 euxassay_010443_04
EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257
euxassay_010443_05 euxassay_010443_06 euxassay_010443_07 euxassay_010443_08 euxassay_010443_09
EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257
euxassay_010443_10 euxassay_010443_11 euxassay_010443_12 euxassay_010443_13 euxassay_010443_14
EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257
euxassay_010443_15 euxassay_010443_16 euxassay_010443_17 euxassay_010443_18 euxassay_010443_19
EMAGE:15257 EMAGE:15257 EMAGE:15257 EMAGE:15257
euxassay_010443_20 euxassay_010443_21 euxassay_010443_22 euxassay_010443_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15257Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15257_wholemount_strong.wlz
15257_wholemount_moderate.wlz
15257_wholemount_weak.wlz
15257_wholemount_possible.wlz
15257_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15257_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 14 15 16 17
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 09 10 11 14 15 18 20 21 22 23 weak expression: see section 05 06 07 08 19
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15 16 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 13 14 15 16 17 18 weak expression: see section 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 13 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 16 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30203
Entity Detected:Grin1, glutamate receptor, ionotropic, NMDA1 (zeta 1) ( MGI:95819)
Sequence:sense strand is shown

>T30203
ACGGGGCCTAATGACACATCCCCAGGAAGCCCACGTCACACAGTGCCCCAGTGCTGTTATGGCTTCTGCG
TTGACCTGCTCATCAAGCTGGCACGGACCATGAATTTTACCTACGAGGTGCACCTTGTGGCAGATGGCAA
GTTTGGCACACAGGAGCGGGTAAACAACAGCAACAAAAAGGAGTGGAACGGAATGATGGGAGAGCTGCTC
AGTGGTCAAGCAGACATGATCGTGGCTCCACTGACCATTAACAATGAGCGTGCGCAGTACATAGAGTTCT
CCAAGCCCTTCAAGTACCAGGGCCTGACCATTCTGGTCAAGAAGGAGATCCCTCGGAGCACACTGGACTC
ATTCATGCAGCCCTTTCAGAGCACACTGTGGCTGCTGGTGGGGCTGTCAGTTCATGTGGTGGCCGTGATG
CTGTACCTGCTGGACCGCTTCAGTCCCTTTGGCCGATTTAAGGTGAACAGCGAGGAGGAGGAGGAGGATG
CACTGACCCTGTCCTCTGCCATGTGGTTTTCCTGGGGCGTCCTGCTCAACTCTGGCATTGGGGAAGGTGC
CCCCCGGAGTTTCTCTGCTCGTATCCTAGGCATGGTGTGGGCTGGTTTTGCCATGATCATCGTGGCTTCC
TACACTGCCAACCTGGCAGCCTTCCTGGTGCTGGATAGGCCTGAGGAGCGCATCACAGGCATCAATGACC
CCAGGCTCAGAAACCCCTCAGACAAGTTCATCTATGCAACTGTAAAACAGAGCTCTGTGGATATCTACTT
CCGGAGGCAGGTGGAGTTGAGCACCATGTACCGGCACATGGAGAAGCACAATTATGAGAGTGCAGCTGAG
GCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4507986), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 20135. Forward Primer - name:020135_F_IRAV51-54_E01_Grin1, sequence:ACGGGGCCTAATGACACA; Reverse Primer - name:020135_R_SP6_IRAV51-54_E01_Grin1, sequence:ATGGCCTCAGCTGCACTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15254 same embryo
 EMAGE:15256 same embryo
 EMAGE:15253 same embryo
 EMAGE:15255 same embryo
 EMAGE:15252 same embryo
 EurExpress:euxassay_010443 same experiment
 MGI:4825232 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS