Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15291

Vwa5b2 von Willebrand factor A domain containing 5B2 ( MGI:2681859)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15291 EMAGE:15291 EMAGE:15291 EMAGE:15291 EMAGE:15291
"Pseudo-wholemount" of euxassay_010466. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010466_01 euxassay_010466_02 euxassay_010466_03 euxassay_010466_04
EMAGE:15291 EMAGE:15291 EMAGE:15291 EMAGE:15291 EMAGE:15291
euxassay_010466_05 euxassay_010466_06 euxassay_010466_07 euxassay_010466_08 euxassay_010466_09
EMAGE:15291 EMAGE:15291 EMAGE:15291 EMAGE:15291 EMAGE:15291
euxassay_010466_10 euxassay_010466_11 euxassay_010466_12 euxassay_010466_13 euxassay_010466_14
EMAGE:15291 EMAGE:15291 EMAGE:15291 EMAGE:15291 EMAGE:15291
euxassay_010466_15 euxassay_010466_16 euxassay_010466_17 euxassay_010466_18 euxassay_010466_19
EMAGE:15291 EMAGE:15291 EMAGE:15291
euxassay_010466_20 euxassay_010466_21 euxassay_010466_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15291Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15291_wholemount_strong.wlz
15291_wholemount_moderate.wlz
15291_wholemount_weak.wlz
15291_wholemount_possible.wlz
15291_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15291_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 15 weak expression: see section 13 14 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 13 14 15 16 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 15 16
trigeminal v nerve
weak weak
regionalweak expression: see section 08 09 15 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 07 08 10 11 12 13 weak expression: see section 06 09
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 07 12 13
cervical ganglion
weak weak
regionalweak expression: see section 06 07 14
thoracic ganglion
weak weak
regionalweak expression: see section 10
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 moderate expression: see section 04 05 09 12 13 14 15 weak expression: see section 10
neural retina
weak weak
regionalweak expression: see section 02 03 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 weak expression: see section 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30540
Entity Detected:Vwa5b2, von Willebrand factor A domain containing 5B2 ( MGI:2681859)
Sequence:sense strand is shown

>T30540
TTGTGGCTGCAGCTGGTACCATGACAGTGACCCTGTGCAGCAGCCGGGAGTTGCCCTCCAGGCCTGATGG
GGTGATGCATGTGGCCCTGCCCACTGTGTTCACCCCACTGGCCCAGCCAAACCTGCCAGGGTCCCCCAGG
TCTCCGGGGCTCTGTGACGACAGCCCCACCAGCTGCTTCGGGGTAGGCAGCCCTGAGGAGGAAAGGCCGA
CCTGGGAGCAACCAACTGCCACTCCGGACGTGTTCTCAGGCCCTGCCCGCTGTCCTGCTCCGTATACCTT
CTCTTTCGAGATGCTAGTGACCGGACCATGTCTGTTGGCAGGCCTGGAGAGCCCCTCTCATGCTCTGCGT
GCAGATGCCCTCCCTCATGCCAGCTCTGCAGCAACTATCCGTGTCACCCTGGCAGAGGGCCACCAGTGTG
ATCGGGCCTTGGAGATCCTCTTGCACCCCAGTGAGCCCCATCAGCCACACTTGATGCTGGAGACTGGCAG
CTTGAGTTCAGCAGAATATGAGGCCCAAGTGAGGGCCCGCCATGACTTCCAGAGGTTGCAGCAAAGAGAC
AGTGGTGGGGAACGGCAGGTCTGGTTCCTGCAGCGACGGTTCCATAAGGACATCTTGCTGAACCCTGTGC
TGGTGCTGAACTTCTGCCCAGACCTGAGCTCCAAGCCTGGACACCTGAATGCAGCTACCCGGGAGCTCCT
CTTCCTGTTAGATGGCAGTGGTGCAGGACACAAGGATGCCATTGTTTTGGCTGTAAAATCCCTCCCAGCT
CAGACTCTAGTCAACCTAGCCATATTTGGGACATTGGTACAGCCACTCTTCCCAGAGAGCCGGCCTTGCA
GTGATACCTCTGTCTCCAGGACACTGTGCAGCTGATCTGCGAGAGCATCGAGACTCTCCAGACTGTGAAT
GGTCCCCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5695121), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59101. Forward Primer - name:059101_F_IRAV111_b02_BC052055, sequence:TTGTGGCTGCAGCTGGTA; Reverse Primer - name:059101_R_SP6_IRAV111_b02_BC052055, sequence:CAGGGGGACCATTCACAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15288 same embryo
 EMAGE:15290 same embryo
 EMAGE:15287 same embryo
 EMAGE:15289 same embryo
 EMAGE:15292 same embryo
 EurExpress:euxassay_010466 same experiment
 MGI:4829183 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS