Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15357

Nell2 NEL-like 2 (chicken) ( MGI:1858510)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357
"Pseudo-wholemount" of euxassay_010538. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010538_01 euxassay_010538_02 euxassay_010538_03 euxassay_010538_04
EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357
euxassay_010538_05 euxassay_010538_06 euxassay_010538_07 euxassay_010538_08 euxassay_010538_09
EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357
euxassay_010538_10 euxassay_010538_11 euxassay_010538_12 euxassay_010538_13 euxassay_010538_14
EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357
euxassay_010538_15 euxassay_010538_16 euxassay_010538_17 euxassay_010538_18 euxassay_010538_19
EMAGE:15357 EMAGE:15357 EMAGE:15357 EMAGE:15357
euxassay_010538_20 euxassay_010538_21 euxassay_010538_22 euxassay_010538_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15357Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15357_wholemount_strong.wlz
15357_wholemount_moderate.wlz
15357_wholemount_weak.wlz
15357_wholemount_possible.wlz
15357_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15357_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 02 03 04 18
peritoneal component
moderate moderate
regionalmoderate expression: see section 01 02 03 04 19 20 21 22 23
forearm mesenchyme
moderate moderate
regionalmoderate expression: see section 23
upper arm mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 20 23
hand
moderate moderate
regionalmoderate expression: see section 01
interdigital region between forelimb digits 3 and 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 20 21
interdigital region between forelimb digits 4 and 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 21
foot
moderate moderate
regionalmoderate expression: see section 09 23
interdigital region between hindlimb digits 1 and 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 08 09
interdigital region between hindlimb digits 2 and 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 08 09
interdigital region between hindlimb digits 3 and 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 08 09
interdigital region between hindlimb digits 4 and 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 08 09
lower leg mesenchyme
moderate moderate
regionalmoderate expression: see section 04 21 22 23
upper leg mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 19 20 23
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 10 11 12 18 19 20 21 22 23
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21 22
cerebral cortex ventricular layer
strong strong
regionalstrong expression: see section 09
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 04 05 06 07 08 09 10 11 12
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 13 14 15 16 17 18
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 12
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 12 13 14 15 16 17 18
metencephalon rest of alar plate mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20
pons mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 11 12 13 14
brachial plexus
moderate moderate
regionalmoderate expression: see section 06 15
perioptic mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 20 21 22 23
neural retina
strong strong
regionalstrong expression: see section 22 moderate expression: see section 01 02 03 20 21 23
nasal cavity olfactory epithelium
moderate moderate
single cellmoderate expression: see section 08 09 10 11 13 15 16
esophagus mesentery
moderate moderate
regionalmoderate expression: see section 10
stomach mesentery
moderate moderate
regionalmoderate expression: see section 02 03 04 06 07 08 09 10
rest of midgut mesentery
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 12 13
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 16 17
axial skeleton
moderate moderate
regionalmoderate expression: see section 06 07 08 12 13
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 14 15 17 18
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30571
Entity Detected:Nell2, NEL-like 2 (chicken) ( MGI:1858510)
Sequence:sense strand is shown

>T30571
ACGAGTGTGCAGAAGGGCGCCATTACTGCCGTGAGAACACCATGTGTGTGAATACACCTGGTTCTTTCAT
GTGTATCTGCAAAACTGGGTACATCAGGATCGACGATTACTCATGTACAGAACATGATGAGTGTCTCACA
AACCAGCACAATTGTGATGAAAACGCTTTGTGCTTTAACACTGTTGGAGGACACAACTGTGTCTGCAAGC
CTGGCTACACCGGGAATGGAACCACGTGCAAAGCTTTCTGCAAAGATGGCTGTAGAAACGGAGGAGCGTG
CATTGCTGCCAATGTGTGTGCCTGCCCACAAGGCTTCACGGGACCCAGCTGTGAGACAGACATTGACGAG
TGCTCTGAGGGCTTTGTTCAGTGTGACAGCCGTGCCAACTGCATCAACCTGCCTGGGTGGTATCACTGTG
AGTGCAGAGACGGCTACCATGACAATGGGATGTTTGCGCCAGGCGGAGAATCCTGTGAAGATATTGACGA
ATGCGGGACTGGGAGGCACAGCTGCACCAACGACACCATTTGCTTCAACTTGGACGGGGGATACGATTGC
CGGTGTCCCCATGGGAAGAACTGCACTGGGGACTGCGTGCACGAGGGGAAAGTGAAGCACACCGGCCAGA
TCTGGGTGCTGGAAAACGACAGGTGCTCCGTGTGTTCCTGCCAGACTGGGTTTGTCATGTGTCGACGGAT
GGTCTGCGACTGCGAAAACCCCACAGTTGACCTTTCCTGCTGCCCTGAGTGTGACCCAAGGCTGAGCAGT
CAGTGCCTGCATCAAAACGGGGAAACCGTGTACAACAGCGGCGACACCTGGGTCCAGGATTGCCGTCAGT
GCCGCTGCTTGCAAGGAGAAGTTGACTGTTGGCCCCTGGCTTGCCCAGAGGTAGAATGTGAATTTAGCGT
CCTTCCTGAGAACGAGTGCTGCCCACGCTGTGTCACCGATCCTTGTCAGGCCGACACCATCCGCAATGAC
ATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6401465), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58995. Forward Primer - name:058995_F_IRAV112_f01_Nell2, sequence:ACGAGTGTGCAGAAGGGC; Reverse Primer - name:058995_R_SP6_IRAV112_f01_Nell2, sequence:TGATGTCATTGCGGATGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15360 same embryo
 EMAGE:15355 same embryo
 EMAGE:15358 same embryo
 EMAGE:15356 same embryo
 EMAGE:15359 same embryo
 EurExpress:euxassay_010538 same experiment
 MGI:4826665 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS