Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15520

Phlpp1 PH domain and leucine rich repeat protein phosphatase 1 ( MGI:2138327)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520
"Pseudo-wholemount" of euxassay_010722. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010722_01 euxassay_010722_02 euxassay_010722_03 euxassay_010722_04
EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520
euxassay_010722_05 euxassay_010722_06 euxassay_010722_07 euxassay_010722_08 euxassay_010722_09
EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520
euxassay_010722_10 euxassay_010722_11 euxassay_010722_12 euxassay_010722_13 euxassay_010722_14
EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520
euxassay_010722_15 euxassay_010722_16 euxassay_010722_17 euxassay_010722_18 euxassay_010722_19
EMAGE:15520 EMAGE:15520 EMAGE:15520 EMAGE:15520
euxassay_010722_20 euxassay_010722_21 euxassay_010722_22 euxassay_010722_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15520Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15520_wholemount_strong.wlz
15520_wholemount_moderate.wlz
15520_wholemount_weak.wlz
15520_wholemount_possible.wlz
15520_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15520_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38315
Entity Detected:Phlpp1, PH domain and leucine rich repeat protein phosphatase 1 ( MGI:2138327)
Sequence:sense strand is shown

>T38315
GCATCTGAGATCAGCAGTGAACTGTCTACCTCCGAGATGAGTAGTGAGGTGGGCTCCACAGCCTCTGATG
AGCCCCCGTCTGGAGTCCTGAATGAGAGCAGCCCTGCCTACCCCAACGAGCAGCGCTGCATGCTCCACCC
TGTCTGCCTGTCTAACTCCTTCCAACGTCAGCTGTCCAGCGCTACTTTCTCCAGCGCGTTCTCTGACAAC
GGCCTTGACAGTGACGATGAAGAACCCATTGAGGGGGTGTTCAGCAACGGCAGCCGGGTTGAGGTGGAAG
TAGACATCCACTGCAGCAGGGCCAAGGAAAAGGAGAGACAGCAGCACCTACTTCAGGTGCCAGCTGAGGC
CAGTGATGAGGGCATTGTCATCAGTGCCAATGAGGATGAGTCAGGTCTGTCCAAGAAGGCAGACTTTTCT
GCTGTGGGAACCATTGGACGACGCAGGGCTAATGGCTCTGTAGCTCCCCAGGAAAGGAGCCATAATGTGA
TAGAGGTTGCTGCAGATGCGCCTCTCCGGAAGCCAGGAGGCTATTTTGCAGCCCCTGCTCAGCCAGATCC
AGATGATCAGTTTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 144361. Forward Primer - name:144361_F_cDNA_Plekhe1, sequence:GCATCTGAGATCAGCAGTGAAC; Reverse Primer - name:144361_N_SP6_cDNA_Plekhe1, sequence:TAAACTGATCATCTGGATCTGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15522 same embryo
 EMAGE:15518 same embryo
 EMAGE:15521 same embryo
 EMAGE:15519 same embryo
 EurExpress:euxassay_010722 same experiment
 MGI:4827191 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS