Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15560

Npr3 natriuretic peptide receptor 3 ( MGI:97373)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560
"Pseudo-wholemount" of euxassay_010728. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010728_01 euxassay_010728_02 euxassay_010728_03 euxassay_010728_04
EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560
euxassay_010728_05 euxassay_010728_06 euxassay_010728_07 euxassay_010728_08 euxassay_010728_09
EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560
euxassay_010728_10 euxassay_010728_11 euxassay_010728_12 euxassay_010728_13 euxassay_010728_14
EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560
euxassay_010728_15 euxassay_010728_16 euxassay_010728_17 euxassay_010728_18 euxassay_010728_19
EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560 EMAGE:15560
euxassay_010728_20 euxassay_010728_21 euxassay_010728_22 euxassay_010728_23 euxassay_010728_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15560Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15560_wholemount_strong.wlz
15560_wholemount_moderate.wlz
15560_wholemount_weak.wlz
15560_wholemount_possible.wlz
15560_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15560_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pancreas
strong strong
regionalstrong expression: see section 08 09 10 11
diencephalon roof plate
strong strong
regionalstrong expression: see section 12 13
choroid invagination
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 16 17 18 19 20
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
spinal cord mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
endolymphatic duct
strong strong
regionalstrong expression: see section 01 21 22
cochlea
strong strong
regionalstrong expression: see section 05 06 07 08 09 17 18 19 20
utricle
strong strong
regionalstrong expression: see section 04 05 06 07 19 20 21 22
cornea
strong strong
regionalstrong expression: see section 01 02 03 04
heart atrium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
endocardial tissue
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
kidney calyx
strong strong
regionalstrong expression: see section 07 08 09 10 18 19 20 21
left lung
strong strong
regionalstrong expression: see section 02 03 moderate expression: see section 04 05 06 07 08 09 10 11
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 23 24
tail mesenchyme
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38309
Entity Detected:Npr3, natriuretic peptide receptor 3 ( MGI:97373)
Sequence:sense strand is shown

>T38309
ACTTGGACCTGGACGACATAGTGCGCTACATCCAAGGCAGCGAGCGAGTGGTGATCATGTGTGCCAGTGG
TGACACCATTCGGAGAATCATGTTGGCGGTGCACAGACACGGCATGACCAGTGGAGACTACGCTTTCTTC
AACATTGAACTCTTCAACAGTTCTTCCTACGGAGATGGCTCGTGGAGGAGAGGAGACAAACACGACTCTG
AAGCTAAACAAGCATACTCGTCCCTCCAAACAGTCACCCTACTGAGGACCGTGAAACCTGAGTTTGAGAA
GTTTTCCATGGAGGTGAAAAGTTCTGTTGAGAAACAAGGGCTCAATGAGGAGGATTACGTGAACATGTTT
GTTGAAGGGTTCCATGACGCCATCCTCCTCTACGTTCTGGCTTTACATGAAGTACTCAGAGCTGGCTACA
GCAAGAAGGATGGGGGGAAAATCATCCAGCAGACTTGGAACAGGACATTTGAAGGTATCGCCGGGCAGGT
GTCCATAGATGCCAACGGGGACCGGTATGGGGACTTCTCTGTGGTTGCTATGACTGACACTGAAGCAGGC
ACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 147025. Forward Primer - name:147025_F_cDNA_Npr3, sequence:ACTTGGACCTGGACGACATAGT; Reverse Primer - name:147025_N_SP6_cDNA_Npr3, sequence:GGTGCCTGCTTCAGTGTCAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15559 same embryo
 EMAGE:15562 same embryo
 EMAGE:15558 same embryo
 EMAGE:15561 same embryo
 EMAGE:15563 same embryo
 EurExpress:euxassay_010728 same experiment
 MGI:4826772 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS