Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15716

Myh3 myosin, heavy polypeptide 3, skeletal muscle, embryonic ( MGI:1339709)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716
"Pseudo-wholemount" of euxassay_010874. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010874_01 euxassay_010874_02 euxassay_010874_03 euxassay_010874_04
EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716
euxassay_010874_05 euxassay_010874_06 euxassay_010874_07 euxassay_010874_08 euxassay_010874_09
EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716
euxassay_010874_10 euxassay_010874_11 euxassay_010874_12 euxassay_010874_13 euxassay_010874_14
EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716
euxassay_010874_15 euxassay_010874_16 euxassay_010874_17 euxassay_010874_18 euxassay_010874_19
EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716 EMAGE:15716
euxassay_010874_20 euxassay_010874_21 euxassay_010874_22 euxassay_010874_23 euxassay_010874_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15716Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15716_wholemount_strong.wlz
15716_wholemount_moderate.wlz
15716_wholemount_weak.wlz
15716_wholemount_possible.wlz
15716_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15716_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 17 18 19 20 21 22 23 24
upper leg muscle
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 21 22 23 24 not examined expression: see section 20
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 16 17 18 19 20 21 22 23 24
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03
hand
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 24
foot
strong strong
regionalstrong expression: see section 11 12 13
not examined not examined
regionalnot examined expression: see section 20
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 07 08
upper leg rest of mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 12
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
heart atrium
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
heart ventricle
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
tongue muscle
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38446
Entity Detected:Myh3, myosin, heavy polypeptide 3, skeletal muscle, embryonic ( MGI:1339709)
Sequence:sense strand is shown

>T38446
GGCTCAAGAAGAAGGACTTTGAATATAGTCAGCTGCAAAGCAAAGTGGAAGATGAGCAGACCTTGAGCCT
CCAGCTTCAGAAGAAAATCAAGGAGCTACAGGCTCGCATCGAGGAGCTGGAGGAAGAGATAGAGGCAGAG
AGGGCCACCCGGGCCAAGACAGAGAAGCAGCGCAGCGACTATGCACGCGAGCTGGAGGAGCTGAGTGAGC
GGCTGGAGGAGGCGGGCGGTGTCACCTCCACCCAGATCGAACTGAACAAGAAGCGTGAGGCTGAGTTCTT
GAAGCTGCGCAGGGACCTGGAGGAGGCCACCCTGCAGCACGAGGCCACGGTGGCCACGCTGCGGAAGAAG
CACGCGGACAGCGCGGCCGAGCTGGCGGAGCAGATCGACAACCTGCAGCGGGTGAAGCAGAAGCTGGAGA
AGGAGAAGAGCGAGTTCAAGCTGGAGATTGACGACCTCTCCAGCAGCGTAGAGAGCGTGTCCAAATCCAA
G
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 149776. Forward Primer - name:149776_F_cDNA_Myh3, sequence:GGCTCAAGAAGAAGGACTTTGA; Reverse Primer - name:149776_N_SP6_cDNA_Myh3, sequence:CTTGGATTTGGACACGCTCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15714 same embryo
 EMAGE:15717 same embryo
 EMAGE:15713 same embryo
 EMAGE:15715 same embryo
 EMAGE:15712 same embryo
 EurExpress:euxassay_010874 same experiment
 MGI:4826542 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS