Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15811

Sema3d sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D ( MGI:1860118)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811
"Pseudo-wholemount" of euxassay_013219. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013219_01 euxassay_013219_02 euxassay_013219_03 euxassay_013219_04
EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811
euxassay_013219_05 euxassay_013219_06 euxassay_013219_07 euxassay_013219_08 euxassay_013219_09
EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811
euxassay_013219_10 euxassay_013219_11 euxassay_013219_12 euxassay_013219_13 euxassay_013219_14
EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811
euxassay_013219_15 euxassay_013219_16 euxassay_013219_17 euxassay_013219_18 euxassay_013219_19
EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811 EMAGE:15811
euxassay_013219_20 euxassay_013219_21 euxassay_013219_22 euxassay_013219_23 euxassay_013219_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15811Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15811_wholemount_strong.wlz
15811_wholemount_moderate.wlz
15811_wholemount_weak.wlz
15811_wholemount_possible.wlz
15811_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15811_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
pericardial cavity
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
peritoneal component
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 19 20 21
pleural cavity
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hand mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 22 23
hindlimb digit 1 mesenchyme
weak weak
regionalweak expression: see section 05 21
hindlimb digit 2 mesenchyme
weak weak
regionalweak expression: see section 05 19 20 21
hindlimb digit 3 mesenchyme
weak weak
regionalweak expression: see section 05 06 19 20 21
hindlimb digit 4 mesenchyme
weak weak
regionalweak expression: see section 06 19 20 21
hindlimb digit 5 mesenchyme
weak weak
regionalweak expression: see section 19
foot mesenchyme
weak weak
regionalweak expression: see section 04 07
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 16 17 18
ear
weak weak
regionalweak expression: see section 01 02 03 04 05 19 20 21 22 23
cornea
weak weak
regionalweak expression: see section 01 02 03 04 22 23
naris
weak weak
regionalweak expression: see section 11 12 14 15 16
nasal septum
weak weak
regionalweak expression: see section 10 12 13 14 15 16
esophagus
moderate moderate
regionalmoderate expression: see section 11
mandible
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 04 05 06 07 08 17 18 19 20 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 12 13 15 16
maxilla
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 12 13 15 16
male reproductive system
weak weak
regionalweak expression: see section 12 14 15
urethra of male
moderate moderate
regionalmoderate expression: see section 13
thyroid cartilage
weak weak
regionalweak expression: see section 11 12
trachea
weak weak
regionalweak expression: see section 12
clavicle
moderate moderate
regionalmoderate expression: see section 07 08 15 weak expression: see section 06 14 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39063
Entity Detected:Sema3d, sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D ( MGI:1860118)
Sequence:sense strand is shown

>T39063
TGAGCAGATGTGGTACAAGGAGAAGCGGAGACAGCGCAACAAGGGCAGCCCAAAGTGGAAGCACATGCAG
GAAATGAAGAAGAAACGAAATCGACGACATCACAGAGACCTCGATGAGCTCCAGAGATCAGTAGCTACAT
AGTTTTCTATTTAATTTAAAGAGGGAATTATTTACCTGCCTGCACAAATAATGTCTTCTGTTTTGTACAT
CCCTTATACTAACTCATACATGCTTCCCATGGAGTCTCACGGAGGCACAGGATGCTATGCTGAGTAAGAC
TATATAGGACATCATCTGAACCAGCTTTCCAAGAACAAAATCTGTATCAGCAAAGTTAAGAATTGTCTTA
AAAATAGGGGCCTTATGTTTGTAAATGTCTCATAGTTTGAATTTAATGTCATGTAAATAATCAAGTTAAA
TGAACCCAGGTCCACTTAGTAAGGGCGTTATTCCCGTGCATGTCCATTAAGCATGGACTTTCCCATGCTG
CTGGCTATGTGCTTAATCATTCCATTCTAGAACAGGTGATCATGTAGGAACTGGAGAAAAGGCACACTTT
AAAACAGCTTATGTTAGCAAAAAAAAAACTTTCTCAAGGAGCCAACAGGCCACACTTGGAGTCAGGCGTG
GGAATTTAGAAAGGCATGTTCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 71609. Forward Primer - name:071609_F_cDNA_Sema3d, sequence:TGAGCAGATGTGGTACAAGGAG; Reverse Primer - name:071609_N_SP6_cDNA_Sema3d, sequence:GGGAACATGCCTTTCTAAATTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15810 same embryo
 EMAGE:15813 same embryo
 EMAGE:15812 same embryo
 EMAGE:15809 same embryo
 EMAGE:15814 same embryo
 EurExpress:euxassay_013219 same experiment
 MGI:4827945 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS