Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15905

Hs3st4 heparan sulfate (glucosamine) 3-O-sulfotransferase 4 ( MGI:1333792)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905
"Pseudo-wholemount" of euxassay_013327. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013327_01 euxassay_013327_02 euxassay_013327_03 euxassay_013327_04
EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905
euxassay_013327_05 euxassay_013327_06 euxassay_013327_07 euxassay_013327_08 euxassay_013327_09
EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905
euxassay_013327_10 euxassay_013327_11 euxassay_013327_12 euxassay_013327_13 euxassay_013327_14
EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905
euxassay_013327_15 euxassay_013327_16 euxassay_013327_17 euxassay_013327_18 euxassay_013327_19
EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905 EMAGE:15905
euxassay_013327_20 euxassay_013327_21 euxassay_013327_22 euxassay_013327_23 euxassay_013327_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15905Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15905_wholemount_strong.wlz
15905_wholemount_moderate.wlz
15905_wholemount_weak.wlz
15905_wholemount_possible.wlz
15905_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15905_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 16 18 moderate expression: see section 17
thalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 10 16 moderate expression: see section 11 17
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 15 16 18 19 20 22 23 24 moderate expression: see section 12 13 14 21
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 15 16 22 23 24 moderate expression: see section 06 07 12 13 14 20 21
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 09 10 11 12 13
pons mantle layer
strong strong
regionalstrong expression: see section 07 08 15 16 17 18 19 moderate expression: see section 05 06 09 10 11 12 13
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 16 17 18 moderate expression: see section 09 10 11 12 13 14 15
spinal cord mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39879
Entity Detected:Hs3st4, heparan sulfate (glucosamine) 3-O-sulfotransferase 4 ( MGI:1333792)
Sequence:sense strand is shown

>T39879
GCAGATAACCATGGAGAAGACCCCCAGTTATTTTGTGACGAATGAGGCTCCCAAGCGCATCCACTCTATG
GCCAAGGATATCAAACTCATTGTGGTGGTACGAAACCCAGTGACCAGGGCCATTTCTGACTATACCCAGA
CACTGTCAAAAAAGCCAGAGATCCCCACCTTTGAGGTTCTGGCCTTCAAAAACCGGACCCTGGGGCTGAT
TGATGCCTCTTGGAGCGCCATTCGCATTGGGATCTATGCTTTGCACCTGGAGAACTGGCTGCAGTACTTT
CCCCTTTCTCAGATCCTGTTTGTCAGTGGTGAGCGACTCATAGTGGACCCTGCAGGGGAGATGGCCAAGG
TCCAGGATTTCCTAGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 149451. Forward Primer - name:149451_F_cDNA_LOC384670, sequence:GCAGATAACCATGGAGAAGACC; Reverse Primer - name:149451_N_SP6_cDNA_LOC384670, sequence:GCCTAGGAAATCCTGGACCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15902 same embryo
 EMAGE:15901 same embryo
 EMAGE:15906 same embryo
 EMAGE:15903 same embryo
 EMAGE:15904 same embryo
 EurExpress:euxassay_013327 same experiment
 MGI:4825455 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS