Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15962

D630045J12Rik RIKEN cDNA D630045J12 gene ( MGI:2669829)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15962 EMAGE:15962 EMAGE:15962 EMAGE:15962 EMAGE:15962
"Pseudo-wholemount" of euxassay_013378. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013378_01 euxassay_013378_02 euxassay_013378_03 euxassay_013378_04
EMAGE:15962 EMAGE:15962 EMAGE:15962 EMAGE:15962 EMAGE:15962
euxassay_013378_05 euxassay_013378_06 euxassay_013378_07 euxassay_013378_08 euxassay_013378_09
EMAGE:15962 EMAGE:15962 EMAGE:15962 EMAGE:15962 EMAGE:15962
euxassay_013378_10 euxassay_013378_11 euxassay_013378_12 euxassay_013378_13 euxassay_013378_14
EMAGE:15962 EMAGE:15962 EMAGE:15962 EMAGE:15962 EMAGE:15962
euxassay_013378_15 euxassay_013378_16 euxassay_013378_17 euxassay_013378_18 euxassay_013378_19
EMAGE:15962 EMAGE:15962
euxassay_013378_20 euxassay_013378_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15962Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15962_wholemount_strong.wlz
15962_wholemount_moderate.wlz
15962_wholemount_weak.wlz
15962_wholemount_possible.wlz
15962_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15962_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 03 16
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04
trigeminal v ganglion
strong strong
regionalstrong expression: see section 17 18 moderate expression: see section 02 03 04 05 06 15 16
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 15
spinal cord
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 12 13
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 20 21
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 13 14
lower jaw molar
strong strong
regionalstrong expression: see section 05 06 16
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 14
upper jaw molar
strong strong
regionalstrong expression: see section 05 16 17
metanephros
moderate moderate
regionalmoderate expression: see section 05 06 07 13 14 15
trachea cartilaginous ring
strong strong
regionalstrong expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40026
Entity Detected:D630045J12Rik, RIKEN cDNA D630045J12 gene ( MGI:2669829)
Sequence:sense strand is shown

>T40026
CAACAGACTCAAAGTACAGCGGAGCCCAGTTTCTTTGAGGCAAATTACGGATCCGTGACGAGTAATGAGG
TGGCCCTCGATGATGAGGAGATGGATAACTTTTTGCCAGATGCTCATTGGACCTCTTCAAGGGGGGTTTC
CCCAATGCGGTATATCACACCGAGTCCACCAGAGCCACCCCAGGAAATGCTGGAGCCTGGCACGACCCCA
TCACTTCCCACCATTTCTTTGCCGGATGAAGTGCTGTCCGGATGTCAGAACACAGTGCAACAGGCAACTG
TATATGTGGAGCCGTCCACGTACTTCGGCACTTCTTGGTCAGCTTTTCTCACGTCTGAGGGCATCATTCC
AACTCCTAGTAGGAATTCGGTGCTTCATCCTATAGAAATTCACAGCCAGTTATCAAGCAAGGCTTTGCCA
GAGACAGTAGCTTCTGTAACAGAGGGCGCAGAAAACCTCCTTTTTAGCTCCCGGATTTCAGTGTCTCAGC
CATCAGGCAATGGCATGACTCAACAGCCATCTGTCCCCCTGTGGGAGGTCTCACAGCCTCTAGTGGGTGT
CCTGGCCACAAGCTCGGACAGATACCCTAATGAGACCACTGCTTGGATCGAACACCCAGAGGAAGCCATC
GCTCTAAGAGCACACCCTGGCATAACCACGTCACCCACAGACCCCACTTTTAGCAGTCAGCCTTCTGCTC
TATTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 107977. Forward Primer - name:107977_F_cDNA_LOC434006, sequence:CAACAGACTCAAAGTACAGCGG; Reverse Primer - name:107977_N_SP6_cDNA_LOC434006, sequence:AAAATAGAGCAGAAGGCTGACTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15963 same embryo
 EMAGE:15961 same embryo
 EMAGE:15960 same embryo
 EMAGE:15959 same embryo
 EMAGE:15964 same embryo
 EurExpress:euxassay_013378 same experiment
 MGI:4824207 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS