Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15989

Fam69c family with sequence similarity 69, member C ( MGI:3041188)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989
"Pseudo-wholemount" of euxassay_013427. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013427_01 euxassay_013427_02 euxassay_013427_03 euxassay_013427_04
EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989
euxassay_013427_05 euxassay_013427_06 euxassay_013427_07 euxassay_013427_08 euxassay_013427_09
EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989
euxassay_013427_10 euxassay_013427_11 euxassay_013427_12 euxassay_013427_13 euxassay_013427_14
EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989
euxassay_013427_15 euxassay_013427_16 euxassay_013427_17 euxassay_013427_18 euxassay_013427_19
EMAGE:15989 EMAGE:15989 EMAGE:15989 EMAGE:15989
euxassay_013427_20 euxassay_013427_21 euxassay_013427_22 euxassay_013427_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15989Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15989_wholemount_strong.wlz
15989_wholemount_moderate.wlz
15989_wholemount_weak.wlz
15989_wholemount_possible.wlz
15989_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15989_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 12
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 12 13
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 16 17
telencephalon ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 11 12 15 16 17 18 20 21 22
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 10 11 13 15
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 14 16 17 18 weak expression: see section 07 08 09 10 11 13 15
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 08 09 10 11 12 13
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14
inner ear vestibular component
moderate moderate
regionalmoderate expression: see section 10 16 17 18 weak expression: see section 07 08 09
neural retina
weak weak
regionalweak expression: see section 02 03 04 05 23
lower lip
moderate moderate
regionalmoderate expression: see section 08 12 15 16 17 18 19 weak expression: see section 07 20
upper lip
moderate moderate
regionalmoderate expression: see section 07 08 18 19 20 21 weak expression: see section 06 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45301
Entity Detected:Fam69c, family with sequence similarity 69, member C ( MGI:3041188)
Sequence:sense strand is shown

>T45301
ACTCTGAAAGAACTGCAGGAGGCGGAGAAGTAGCCTCTCTCTTGCCTTTGCCATCAAGAGTAGACAGAGG
AAGCGACCTTCAAGGGACTCCTCCTGTAGTTGCTATGCAAATGAGCTGTCAGAGCCCGTGGCATGCTCTT
CTGAAGTGTGCAGCTGAGCTCCCCTTCTGTGGCTGTGACGTGGACCTCTCTTGCTCCTGCCCAGCTCGGT
TCGATCTGGTTTCGTGGCGACCTCCGGTCTGTCACTCCTTCCGCAGTGACCGAAGGGAGGAGTTTTACCA
GAGTTGCCAGTCTGGAACCCTCTGAGGACTGTACACAGACCTTGCCACTATAGACAAGAGGCTGCTGCTC
TTCCTTGTTAGCTGCTAACAAGCTAAAGCGTGGCTGTGGGCATACTGATGGATATGTTTGCAAATAATTG
TGTGCATAATGTTGCACCCATGAGTGTATGAGTGGGTTTGTATATATGAATGTGTATTGTATACACATGA
GTATGTTGTGTGTAAATAAGCATGGGATTGTGTGTATGTAAGTGGGATTGCACATGTTCTCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 185864. Forward Primer - name:185864_F_exon_B230399E16Rik, sequence:ACTCTGAAAGAACTGCAGGAGG; Reverse Primer - name:185864_N_SP6_exon_B230399E16Rik, sequence:ATGAGAACATGTGCAATCCCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15988 same embryo
 EMAGE:15987 same embryo
 EMAGE:15984 same embryo
 EMAGE:15985 same embryo
 EMAGE:15986 same embryo
 EurExpress:euxassay_013427 same experiment
 MGI:4824755 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS