Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16072

Erbb3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) ( MGI:95411)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072
"Pseudo-wholemount" of euxassay_013512. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013512_01 euxassay_013512_02 euxassay_013512_03 euxassay_013512_04
EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072
euxassay_013512_05 euxassay_013512_06 euxassay_013512_07 euxassay_013512_08 euxassay_013512_09
EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072
euxassay_013512_10 euxassay_013512_11 euxassay_013512_12 euxassay_013512_13 euxassay_013512_14
EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072
euxassay_013512_15 euxassay_013512_16 euxassay_013512_17 euxassay_013512_18 euxassay_013512_19
EMAGE:16072 EMAGE:16072 EMAGE:16072 EMAGE:16072
euxassay_013512_20 euxassay_013512_21 euxassay_013512_22 euxassay_013512_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16072Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16072_wholemount_strong.wlz
16072_wholemount_moderate.wlz
16072_wholemount_weak.wlz
16072_wholemount_possible.wlz
16072_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16072_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 19 20 21 22 23
upper leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 15 16 17
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 16 17 18 19 20 21 22 23
foot
moderate moderate
regionalmoderate expression: see section 02 17
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 17 18 19
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 15 16 17 18 19
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 19 20 21 22 23
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 10 11 13 14
external naris epithelium
moderate moderate
regionalmoderate expression: see section 10 11 13 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 17
esophagus
moderate moderate
regionalmoderate expression: see section 11
tongue muscle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
bladder
moderate moderate
regionalmoderate expression: see section 10 11
left lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11
right lung
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
extraembryonic component
moderate moderate
regionalmoderate expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45065
Entity Detected:Erbb3, v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) ( MGI:95411)
Sequence:sense strand is shown

>T45065
ACTCTCTTCTCTTCCCAAGCCTAGGAAAGAGAAGTTTCCCTGTGTCTCTCCCTTCCTGATCCCGTTCCTC
AGGGAGACTCCCTGGAGATATGAAGGATTACTCTCCAGACCCTTTCTCTCAGGCTCTTACTCATTGGGAT
TAGACTCTTAAACTTTGCCTTTCTTCCCCAATCAGACTCTAAAGAAGGGGAGATGAAAGAGAAGAGAAAA
AGTAAGACTTTTGTTTATGAGACTTTTAATCCCAGAGGAAGATTGAGAAGCTCAAAGCTTTGAGGAGTGA
AGTTAGGAGTAGGTACCAGTGACTACGAACTGAACATGCACTGTGAGCCAGGCATCCTCATACTGAACCC
CACCTACATTGTCTCAGTTATAATCTTTCCAGTTTTGTGAGGTAGAACTGATCCTGTTTCACCAATATGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 205012. Forward Primer - name:205012_F_exon_Erbb3, sequence:ACTCTCTTCTCTTCCCAAGCCT; Reverse Primer - name:205012_N_SP6_exon_Erbb3, sequence:CCATATTGGTGAAACAGGATCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16071 same embryo
 EMAGE:16069 same embryo
 EMAGE:16067 same embryo
 EMAGE:16068 same embryo
 EMAGE:16070 same embryo
 EurExpress:euxassay_013512 same experiment
 MGI:4824608 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS